Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0003191

Physical Location & Seq

Genomic Coordinates Reverse (-)

37420551 .. 37422796

Gene Structure 2246 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ57143

Sequence Viewer

CDS Protein Promoter (2k)

Length: 162 bp

ATGGCTTCAAACTCAAAGCGTCTCAAATTATGCTCACATAATGAAGACAGGATCAGTGGGTTGCCAGATGCAATTCTTTGCCACATTCTCTCTTTCTTTTCAATCAGACAGGCTGTAAAGACTAGCATTTTATCACATAAATGGAGGAATGTCTGGGCTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box FBD

Protein Analysis

53

Amino Acids

6.08

Weight (kDa)

10.05

Isoelectric Point (pI)

56.37

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
F-box	PF00646	18 - 52	1e-07	F-box domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003191)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G19070
fragaria_vesca	FvH4_3g18163 FvH4_3g20090
malus_domestica	MD00G1185900.v1.1 MD03G1225700.v1.1 MD03G1253900.v1.1
prunus_persica	Prupe.4G183700_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0345041 RchiOBHm_Chr3g0460671 RchiOBHm_Chr4g0417371 RchiOBHm_Chr5g0030621 RchiOBHm_Chr5g0033891 RchiOBHm_Chr6g0283051 RchiOBHm_Chr7g0197871 RchiOBHm_Chr7g0237061 RchiOBHm_Chr7g0237081
rosa_laevigata	RLG00000033508
rosa_multiflora	Rmu_co8513519.1_g000001 Rmu_sc0001150.1_g000016 Rmu_sc0008328.1_g000003 Rmu_sc0022678.1_g000006
rosa_roxburghii	Rroxscaffold_1G00046320 Rroxscaffold_4G00317750
rosa_rugosa	Rorug03G0129400.1 Rorug05G0143000 Rorug05G0333600 Rorug05G0333700 Rorug05G0333800
rosa_samantha	Rh5AG211200 Rh5AG233900 Rh5BG234500 Rh5CG264800 Rh5DG198300 Rh5DG241400 Rh6BG371200 Rh7AG457800
rosa_wichuraiana	Rw5G021540

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	59
AgsI	TTSAA	2 cut(s)	9, 102
Alw26I	GTCTC	1 cut(s)	26
AlwI	GGATC	1 cut(s)	59
BbsI	GAAGAC	1 cut(s)	51
BcoDI	GTCTC	1 cut(s)	26
BfaI	CTAG	1 cut(s)	123
BmsI	GCATC	1 cut(s)	58
BpiI	GAAGAC	1 cut(s)	51
BsmAI	GTCTC	1 cut(s)	26
BsmBI	CGTCTC	1 cut(s)	26
Bsp143I	GATC	1 cut(s)	51
BspPI	GGATC	1 cut(s)	59
BssMI	GATC	1 cut(s)	51
BstKTI	GATC	1 cut(s)	54
BstMAI	GTCTC	1 cut(s)	26
BstMBI	GATC	1 cut(s)	51
BstV2I	GAAGAC	1 cut(s)	51
BtsIMutI	CAGTG	1 cut(s)	61
CseI	GACGC	1 cut(s)	8
CviJI	RGCY	3 cut(s)	5, 113, 158
CviKI_1	RGCY	3 cut(s)	5, 113, 158
DpnI	GATC	1 cut(s)	53
DpnII	GATC	1 cut(s)	51
Esp3I	CGTCTC	1 cut(s)	26
FaiI	YATR	3 cut(s)	31, 39, 138
FspBI	CTAG	1 cut(s)	123
HgaI	GACGC	1 cut(s)	8
Hpy188I	TCNGA	1 cut(s)	107
HpyCH4V	TGCA	1 cut(s)	71
Kzo9I	GATC	1 cut(s)	51
LpnPI	CCDG	4 cut(s)	34, 78, 95, 139
LweI	GCATC	1 cut(s)	58
MaeI	CTAG	1 cut(s)	123
MalI	GATC	1 cut(s)	53
MboI	GATC	1 cut(s)	51
MboII	GAAGA	1 cut(s)	56
MluCI	AATT	2 cut(s)	26, 72
MnlI	CCTC	1 cut(s)	138
MseI	TTAA	1 cut(s)	160
MslI	CAYNNNNRTG	1 cut(s)	139
NdeII	GATC	1 cut(s)	51
RseI	CAYNNNNRTG	1 cut(s)	139
SaqAI	TTAA	1 cut(s)	160
Sau3AI	GATC	1 cut(s)	51
SfaNI	GCATC	1 cut(s)	58
SgeI	CNNG	4 cut(s)	61, 77, 122, 135
SmiMI	CAYNNNNRTG	1 cut(s)	139
Sse9I	AATT	2 cut(s)	26, 72
SspMI	CTAG	1 cut(s)	123
TasI	AATT	2 cut(s)	26, 72
Tru1I	TTAA	1 cut(s)	160
Tru9I	TTAA	1 cut(s)	160
TscAI	CASTG	1 cut(s)	61
TspDTI	ATGAA	1 cut(s)	57
TspRI	CASTG	1 cut(s)	61
XspI	CTAG	1 cut(s)	123

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.