RchiOBHm_Chr7g0237061

LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0003191
Physical Location & Seq
Reverse (-)
61956821 .. 61957195
375 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21245

Sequence Viewer

Length: 375 bp
ATGGCTATAAAATTCAAGAGTAAAGTGAGAGTTAAAGATAGAATCAGTGACTTACCAGATGCAATTCTTTGTCACATCCTTTCCTTCATTCCAACAAAATATGCTGTGAGGACTGTCACTTTGTCTACAAGATGGAAGAAAGTGTGGGCGTCTGTTCCCTGCCTAGACTTCTGTCCCAAAGATTTTGATTTCTATGAAAGTTTTCTGATGTTTGTTAGTCGCTTACTTCTATATCGTGGCTCATCAGACATTCAAAAGTTCCGACTTCGTTGTCTGAAGAATGATAGTCAGTTCCCCCTTATTGACGGTTGGATTTGCACCACTATTATGAGGCATGTTGTTGAACTTGATCTTGATGTTCCAGGAGGTTCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBD LRR_2

Protein Analysis

124

Amino Acids

14.41

Weight (kDa)

9.22

Isoelectric Point (pI)

42.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 15 - 54 4.7e-08 F-box domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 270
AccI GTMKAC 1 cut(s) 125
AcsI RAATTY 1 cut(s) 11
AcuI CTGAAG 1 cut(s) 296
AcyI GRCGYC 1 cut(s) 149
AgsI TTSAA 3 cut(s) 16, 254, 344
AjnI CCWGG 1 cut(s) 361
ApoI RAATTY 1 cut(s) 11
ArsI GACNNNNNNTTYG 2 cut(s) 103, 135
Asp700I GAANNNNTTC 1 cut(s) 201
BccI CCATC 1 cut(s) 126
BciT130I CCWGG 1 cut(s) 363
BfaI CTAG 1 cut(s) 164
Bme1390I CCNGG 1 cut(s) 363
BmiI GGNNCC 1 cut(s) 370
BmrFI CCNGG 1 cut(s) 363
BmsI GCATC 1 cut(s) 49
BoxI GACNNNNGTC 1 cut(s) 171
BsaHI GRCGYC 1 cut(s) 149
BseBI CCWGG 1 cut(s) 363
BseGI GGATG 1 cut(s) 75
BslFI GGGAC 1 cut(s) 159
BsmFI GGGAC 1 cut(s) 159
Bsp143I GATC 1 cut(s) 349
BspLI GGNNCC 1 cut(s) 370
BssMI GATC 1 cut(s) 349
BssNI GRCGYC 1 cut(s) 149
Bst2UI CCWGG 1 cut(s) 363
Bst4CI ACNGT 2 cut(s) 115, 308
BstACI GRCGYC 1 cut(s) 149
BstF5I GGATG 1 cut(s) 75
BstKTI GATC 1 cut(s) 352
BstMBI GATC 1 cut(s) 349
BstNI CCWGG 1 cut(s) 363
BstNSI RCATGY 1 cut(s) 338
BstPAI GACNNNNGTC 1 cut(s) 171
BstSCI CCNGG 1 cut(s) 361
BtsCI GGATG 1 cut(s) 75
BtsIMutI CAGTG 1 cut(s) 52
CseI GACGC 1 cut(s) 138
CviAII CATG 1 cut(s) 335
CviJI RGCY 2 cut(s) 5, 240
CviKI_1 RGCY 2 cut(s) 5, 240
DpnI GATC 1 cut(s) 351
DpnII GATC 1 cut(s) 349
DrdI GACNNNNNNGTC 1 cut(s) 270
DseDI GACNNNNNNGTC 1 cut(s) 270
Eco57I CTGAAG 1 cut(s) 296
EcoRII CCWGG 1 cut(s) 361
FaeI CATG 1 cut(s) 338
FaiI YATR 6 cut(s) 8, 102, 195, 232, 329, 336
FaqI GGGAC 1 cut(s) 159
FatI CATG 1 cut(s) 334
FblI GTMKAC 1 cut(s) 125
FokI GGATG 1 cut(s) 62
FspBI CTAG 1 cut(s) 164
HgaI GACGC 1 cut(s) 138
Hin1I GRCGYC 1 cut(s) 149
Hin1II CATG 1 cut(s) 338
HinfI GANTC 1 cut(s) 42
Hpy166II GTNNAC 1 cut(s) 126
Hpy188I TCNGA 4 cut(s) 207, 247, 263, 276
Hpy188III TCNNGA 3 cut(s) 16, 353, 372
Hpy8I GTNNAC 1 cut(s) 126
HpyAV CCTTC 1 cut(s) 94
HpyCH4III ACNGT 2 cut(s) 115, 308
HpyCH4V TGCA 2 cut(s) 62, 318
Hsp92I GRCGYC 1 cut(s) 149
Hsp92II CATG 1 cut(s) 338
Kzo9I GATC 1 cut(s) 349
LpnPI CCDG 3 cut(s) 69, 172, 348
LweI GCATC 1 cut(s) 49
MaeI CTAG 1 cut(s) 164
MaeIII GTNAC 3 cut(s) 47, 71, 115
MalI GATC 1 cut(s) 351
MboI GATC 1 cut(s) 349
MboII GAAGA 2 cut(s) 148, 289
MluCI AATT 2 cut(s) 11, 63
MmeI TCCRAC 3 cut(s) 116, 286, 290
MnlI CCTC 3 cut(s) 102, 324, 359
MroXI GAANNNNTTC 1 cut(s) 201
MseI TTAA 1 cut(s) 33
MslI CAYNNNNRTG 1 cut(s) 326
MspR9I CCNGG 1 cut(s) 363
MvaI CCWGG 1 cut(s) 363
NdeII GATC 1 cut(s) 349
NlaIII CATG 1 cut(s) 338
NlaIV GGNNCC 1 cut(s) 370
NmuCI GTSAC 3 cut(s) 47, 71, 115
NspI RCATGY 1 cut(s) 338
PdmI GAANNNNTTC 1 cut(s) 201
PfeI GAWTC 1 cut(s) 42
PfoI TCCNGGA 1 cut(s) 361
PshAI GACNNNNGTC 1 cut(s) 171
Psp6I CCWGG 1 cut(s) 361
PspGI CCWGG 1 cut(s) 361
PspN4I GGNNCC 1 cut(s) 370
RseI CAYNNNNRTG 1 cut(s) 326
SaqAI TTAA 1 cut(s) 33
Sau3AI GATC 1 cut(s) 349
ScrFI CCNGG 1 cut(s) 363
SetI ASST 1 cut(s) 370
SfaNI GCATC 1 cut(s) 49
SgeI CNNG 9 cut(s) 28, 68, 141, 171, 176, 248, 347, 359, 365
SmiMI CAYNNNNRTG 1 cut(s) 326
Sse9I AATT 2 cut(s) 11, 63
SspMI CTAG 1 cut(s) 164
StyD4I CCNGG 1 cut(s) 361
TaaI ACNGT 2 cut(s) 115, 308
TasI AATT 2 cut(s) 11, 63
TfiI GAWTC 1 cut(s) 42
Tru1I TTAA 1 cut(s) 33
Tru9I TTAA 1 cut(s) 33
TscAI CASTG 1 cut(s) 52
TseFI GTSAC 3 cut(s) 47, 71, 115
Tsp45I GTSAC 3 cut(s) 47, 71, 115
TspDTI ATGAA 2 cut(s) 76, 210
TspRI CASTG 1 cut(s) 52
XapI RAATTY 1 cut(s) 11
XceI RCATGY 1 cut(s) 338
XmiI GTMKAC 1 cut(s) 125
XmnI GAANNNNTTC 1 cut(s) 201
XspI CTAG 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.