Rh6BG371200

domain in FBox and BRCT domain containing plant proteins

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0003191
Physical Location & Seq
Reverse (-)
60061208 .. 60063263
2056 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG371200.1

Sequence Viewer

Length: 279 bp
ATGATTTATATAGCATATGTTCTTTGCATAGTTTCTGAGAAACATTTAGTTTCTTGGAATTGTGATGATTATAACTTAATGGGATTTGAACCGCATTTTATAGGTTTCAAATCAAAAATGGCTTCAAACTCAAAGCGTCTCAAATTATGCTCACACAATGAAGACAGGATCAGTGGGTTGCCAGATGCAATTCTTTGCCACATTCTTTCTTTCTTTTCAATCAGACCGGCTGTAAAGACTAGCATTTTATCACATAAATGGAGGAATGTCTGGGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBD

Protein Analysis

92

Amino Acids

10.64

Weight (kDa)

9.02

Isoelectric Point (pI)

45.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 57 - 91 2.2e-06 F-box domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 72
AciI CCGC 1 cut(s) 92
AclWI GGATC 1 cut(s) 176
AgsI TTSAA 4 cut(s) 89, 109, 126, 219
Alw26I GTCTC 1 cut(s) 143
AlwI GGATC 1 cut(s) 176
BbsI GAAGAC 1 cut(s) 168
BcoDI GTCTC 1 cut(s) 143
BfaI CTAG 1 cut(s) 240
BmsI GCATC 1 cut(s) 175
BpiI GAAGAC 1 cut(s) 168
Bse118I RCCGGY 1 cut(s) 226
BseMII CTCAG 1 cut(s) 27
BsiSI CCGG 1 cut(s) 227
BsmAI GTCTC 1 cut(s) 143
BsmBI CGTCTC 1 cut(s) 143
Bsp143I GATC 1 cut(s) 168
BspACI CCGC 1 cut(s) 92
BspCNI CTCAG 1 cut(s) 28
BspPI GGATC 1 cut(s) 176
BsrFI RCCGGY 1 cut(s) 226
BssAI RCCGGY 1 cut(s) 226
BssMI GATC 1 cut(s) 168
BstDEI CTNAG 1 cut(s) 36
BstKTI GATC 1 cut(s) 171
BstMAI GTCTC 1 cut(s) 143
BstMBI GATC 1 cut(s) 168
BstV2I GAAGAC 1 cut(s) 168
BtsIMutI CAGTG 1 cut(s) 178
Cfr10I RCCGGY 1 cut(s) 226
CseI GACGC 1 cut(s) 125
CviJI RGCY 3 cut(s) 122, 230, 275
CviKI_1 RGCY 3 cut(s) 122, 230, 275
DdeI CTNAG 1 cut(s) 36
DpnI GATC 1 cut(s) 170
DpnII GATC 1 cut(s) 168
Esp3I CGTCTC 1 cut(s) 143
FaiI YATR 9 cut(s) 9, 11, 16, 18, 29, 72, 101, 148, 255
FauNDI CATATG 1 cut(s) 16
FspBI CTAG 1 cut(s) 240
HapII CCGG 1 cut(s) 227
HgaI GACGC 1 cut(s) 125
HpaII CCGG 1 cut(s) 227
Hpy188I TCNGA 2 cut(s) 37, 224
HpyCH4V TGCA 2 cut(s) 27, 188
HpyF3I CTNAG 1 cut(s) 36
Kzo9I GATC 1 cut(s) 168
LpnPI CCDG 4 cut(s) 151, 195, 240, 256
LweI GCATC 1 cut(s) 175
MaeI CTAG 1 cut(s) 240
MalI GATC 1 cut(s) 170
MboI GATC 1 cut(s) 168
MboII GAAGA 1 cut(s) 173
MluCI AATT 3 cut(s) 58, 143, 189
MnlI CCTC 1 cut(s) 255
MseI TTAA 2 cut(s) 77, 277
MslI CAYNNNNRTG 1 cut(s) 256
MspI CCGG 1 cut(s) 227
NdeI CATATG 1 cut(s) 16
NdeII GATC 1 cut(s) 168
PsiI TTATAA 1 cut(s) 72
RseI CAYNNNNRTG 1 cut(s) 256
SaqAI TTAA 2 cut(s) 77, 277
Sau3AI GATC 1 cut(s) 168
SetI ASST 1 cut(s) 106
SfaNI GCATC 1 cut(s) 175
SgeI CNNG 5 cut(s) 66, 178, 194, 239, 252
SmiMI CAYNNNNRTG 1 cut(s) 256
Sse9I AATT 3 cut(s) 58, 143, 189
SsiI CCGC 1 cut(s) 92
SspMI CTAG 1 cut(s) 240
TasI AATT 3 cut(s) 58, 143, 189
Tru1I TTAA 2 cut(s) 77, 277
Tru9I TTAA 2 cut(s) 77, 277
TscAI CASTG 1 cut(s) 178
TspDTI ATGAA 1 cut(s) 174
TspRI CASTG 1 cut(s) 178
XspI CTAG 1 cut(s) 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.