RchiOBHm_Chr3g0460671

LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0003191
Physical Location & Seq
Forward (+)
8695685 .. 8696380
696 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ42717

Sequence Viewer

Length: 177 bp
ATGAAAAAGGGTTCGAACTCAAAGCGTCGACGAAAACGATGCACCGAAGATAGACTCAGTGAATTGCCAGATGCAATTCTTTGCCACATTCTGTCTTTCCTTTCAACAGTTGACGCTGTAAAGACCAGTGTTTTATCACACAGAGGGAGAATGTGTGGGCTTCTGTGCCCACTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBD LRR_2

Protein Analysis

58

Amino Acids

6.53

Weight (kDa)

9.95

Isoelectric Point (pI)

74.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 19 - 48 4.3e-06 F-box domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 28
AgsI TTSAA 1 cut(s) 105
AsuII TTCGAA 1 cut(s) 14
BaeGI GKGCMC 1 cut(s) 170
BcgI CGANNNNNNTGC 2 cut(s) 21, 55
BfmI CTRYAG 1 cut(s) 173
BmsI GCATC 2 cut(s) 29, 61
Bpu14I TTCGAA 1 cut(s) 14
BsaXI ACNNNNNCTCC 2 cut(s) 139, 169
Bse1I ACTGG 1 cut(s) 126
BseMII CTCAG 1 cut(s) 70
BseNI ACTGG 1 cut(s) 126
BseSI GKGCMC 1 cut(s) 170
Bsp119I TTCGAA 1 cut(s) 14
Bsp1286I GDGCHC 1 cut(s) 170
BspCNI CTCAG 1 cut(s) 69
BspT104I TTCGAA 1 cut(s) 14
BsrI ACTGG 1 cut(s) 126
Bst4CI ACNGT 1 cut(s) 109
BstBI TTCGAA 1 cut(s) 14
BstDEI CTNAG 1 cut(s) 56
BstSFI CTRYAG 1 cut(s) 173
BstSLI GKGCMC 1 cut(s) 170
BtsIMutI CAGTG 2 cut(s) 64, 133
CseI GACGC 2 cut(s) 14, 122
CviJI RGCY 1 cut(s) 160
CviKI_1 RGCY 1 cut(s) 160
DdeI CTNAG 1 cut(s) 56
FaiI YATR 1 cut(s) 175
FblI GTMKAC 1 cut(s) 28
FspEI CC 9 cut(s) 58, 81, 98, 113, 129, 130, 139, 141, 142
HgaI GACGC 2 cut(s) 14, 122
HincII GTYRAC 2 cut(s) 29, 112
HindII GTYRAC 2 cut(s) 29, 112
HinfI GANTC 1 cut(s) 54
Hpy166II GTNNAC 2 cut(s) 29, 112
Hpy8I GTNNAC 2 cut(s) 29, 112
Hpy99I CGWCG 2 cut(s) 30, 33
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4V TGCA 2 cut(s) 42, 74
HpyF3I CTNAG 1 cut(s) 56
LpnPI CCDG 2 cut(s) 81, 139
LweI GCATC 2 cut(s) 29, 61
MboII GAAGA 1 cut(s) 59
MhlI GDGCHC 1 cut(s) 170
MluCI AATT 2 cut(s) 62, 75
MlyI GAGTC 1 cut(s) 48
MnlI CCTC 1 cut(s) 137
NspV TTCGAA 1 cut(s) 14
PcsI WCGNNNNNNNCGW 1 cut(s) 34
PleI GAGTC 1 cut(s) 48
PpsI GAGTC 1 cut(s) 48
SalI GTCGAC 1 cut(s) 27
SchI GAGTC 1 cut(s) 48
SduI GDGCHC 1 cut(s) 170
SfaNI GCATC 2 cut(s) 29, 61
SfcI CTRYAG 1 cut(s) 173
SfuI TTCGAA 1 cut(s) 14
SgeI CNNG 2 cut(s) 80, 138
SgrDI CGTCGACG 1 cut(s) 27
Sse9I AATT 2 cut(s) 62, 75
TaaI ACNGT 1 cut(s) 109
TaqI TCGA 2 cut(s) 14, 28
TasI AATT 2 cut(s) 62, 75
TscAI CASTG 2 cut(s) 64, 133
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 2 cut(s) 64, 133
XmiI GTMKAC 1 cut(s) 28
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.