MD00G1185900.v1.1

LRR-repeat protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Reverse (-)
44166984 .. 44167235
252 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1185900.v1.1.491

Sequence Viewer

Length: 252 bp
ATGGGTTCGACATCGAAGTGTCAAGAGCGAGTTGATAGGATCAGTGAATTGCCAAATTCACTTCTTTGCCACATACTTTCATTCTTTCCGATATTAGATGCTGTGCAGACTACAATTCTGTCAAGACGATGGGAGAACTTATGGACTCCTCTTCCCAAACTTGAATTTGATGATGATTGTTTTCCTTATTCATGGATTGAATCCAACATGATTGTTTTCCTTATTCATGGATTGAATCCAATCGTTTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.7

Weight (kDa)

4.85

Isoelectric Point (pI)

59.45

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 14 - 51 4.5e-07 F-box domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 47
AcsI RAATTY 2 cut(s) 55, 164
AgsI TTSAA 3 cut(s) 164, 200, 235
AlwI GGATC 1 cut(s) 47
ApoI RAATTY 2 cut(s) 55, 164
BccI CCATC 1 cut(s) 123
BmsI GCATC 1 cut(s) 88
BseRI GAGGAG 1 cut(s) 138
BsgI GTGCAG 1 cut(s) 125
Bsp143I GATC 1 cut(s) 39
BspPI GGATC 1 cut(s) 47
BssMI GATC 1 cut(s) 39
Bst6I CTCTTC 1 cut(s) 156
BstKTI GATC 1 cut(s) 42
BstMBI GATC 1 cut(s) 39
BtsIMutI CAGTG 1 cut(s) 49
CviAII CATG 3 cut(s) 192, 208, 227
DpnI GATC 1 cut(s) 41
DpnII GATC 1 cut(s) 39
Eam1104I CTCTTC 1 cut(s) 156
EarI CTCTTC 1 cut(s) 156
FaeI CATG 3 cut(s) 195, 211, 230
FaiI YATR 5 cut(s) 74, 142, 193, 209, 228
FatI CATG 3 cut(s) 191, 207, 226
Hin1II CATG 3 cut(s) 195, 211, 230
HinfI GANTC 3 cut(s) 145, 200, 235
Hpy188I TCNGA 1 cut(s) 90
Hpy188III TCNNGA 2 cut(s) 23, 123
HpyCH4V TGCA 1 cut(s) 106
Hsp92II CATG 3 cut(s) 195, 211, 230
Kzo9I GATC 1 cut(s) 39
LweI GCATC 1 cut(s) 88
MalI GATC 1 cut(s) 41
MboI GATC 1 cut(s) 39
MboII GAAGA 1 cut(s) 143
MluCI AATT 4 cut(s) 47, 55, 114, 164
MlyI GAGTC 1 cut(s) 139
MmeI TCCRAC 1 cut(s) 228
MnlI CCTC 1 cut(s) 159
MseI TTAA 1 cut(s) 250
MslI CAYNNNNRTG 1 cut(s) 16
NdeII GATC 1 cut(s) 39
NlaIII CATG 3 cut(s) 195, 211, 230
PfeI GAWTC 2 cut(s) 200, 235
PleI GAGTC 1 cut(s) 139
PpsI GAGTC 1 cut(s) 139
RseI CAYNNNNRTG 1 cut(s) 16
SaqAI TTAA 1 cut(s) 250
Sau3AI GATC 1 cut(s) 39
SchI GAGTC 1 cut(s) 139
SfaNI GCATC 1 cut(s) 88
SgeI CNNG 7 cut(s) 35, 41, 135, 173, 204, 220, 239
SmiMI CAYNNNNRTG 1 cut(s) 16
Sse9I AATT 4 cut(s) 47, 55, 114, 164
TaqI TCGA 2 cut(s) 8, 14
TasI AATT 4 cut(s) 47, 55, 114, 164
TfiI GAWTC 2 cut(s) 200, 235
Tru1I TTAA 1 cut(s) 250
Tru9I TTAA 1 cut(s) 250
TscAI CASTG 1 cut(s) 49
TspDTI ATGAA 3 cut(s) 69, 180, 215
TspRI CASTG 1 cut(s) 49
XapI RAATTY 2 cut(s) 55, 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.