AT1G45223

Encoded by

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0000266
Physical Location & Seq
Forward (+)
17141192 .. 17141771
580 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G45223.1

Sequence Viewer

Length: 348 bp
ATGGTTAGGCTAAGCTCCCATGTTATTGCGCTATTCATTGTTGTAGCTTTGGTGTGTGCGTTTGTTCCTGTATTTTCTGTCGAAGAAGCTGAAGCAAAATCATTATGGAACACTTGTCTAGTTAAAATCACTCCTAAATGTGCATTGAATATAATTTATGTTGTTTTTGGAAATGGAACCCTCATTGAGTCTTGTTGCCACGACCTTGTCCAAGAAGGAAAAGTGTGCCATGATAATCTCATTAAATATATTGCTGACAGACCAAGCTTAATTGGCCGTGAAGCACAATACTTGAAGAAGAGGGATGACGTGTGGAGTCACTGTGTCTCAATTTCTAAAACTGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Prolamin_like

Protein Analysis

115

Amino Acids

12.79

Weight (kDa)

7.59

Isoelectric Point (pI)

37.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Prolamin_like PF05617 38 - 109 1.6e-13 Prolamin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000266)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G45215 AT1G45221 AT1G45223 AT1G57760 AT1G57775 AT1G57777 AT3G30383 AT3G30385 AT3G30387 AT3G44115 AT4G07515 AT4G08025 AT5G34881 AT5G34882 AT5G34883 AT5G34885 AT5G34887 AT5G34905 AT5G34908 AT5G42567 AT5G42955 AT5G42957
prunus_persica Prupe.2G072700_v2.0.a1 Prupe.2G086700_v2.0.a1 Prupe.2G086800_v2.0.a1 Prupe.2G086900_v2.0.a1 Prupe.2G101000_v2.0.a1 Prupe.4G143200_v2.0.a1 Prupe.6G084400_v2.0.a1 Prupe.6G170500_v2.0.a1 Prupe.6G170600_v2.0.a1 Prupe.6G170700_v2.0.a1 Prupe.6G170800_v2.0.a1 Prupe.6G171000_v2.0.a1 Prupe.6G171100_v2.0.a1 Prupe.6G171200_v2.0.a1 Prupe.6G171300_v2.0.a1 Prupe.6G171400_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0046951 RchiOBHm_Chr5g0046961 RchiOBHm_Chr5g0046971 RchiOBHm_Chr5g0051281 RchiOBHm_Chr5g0051291 RchiOBHm_Chr5g0051301 RchiOBHm_Chr5g0051311 RchiOBHm_Chr5g0051321 RchiOBHm_Chr5g0051331 RchiOBHm_Chr5g0051341 RchiOBHm_Chr5g0051391 RchiOBHm_Chr5g0051401 RchiOBHm_Chr5g0051411 RchiOBHm_Chr5g0051421 RchiOBHm_Chr5g0053111 RchiOBHm_Chr5g0053121 RchiOBHm_Chr5g0053141 RchiOBHm_Chr5g0053151 RchiOBHm_Chr5g0053161 RchiOBHm_Chr5g0053171 RchiOBHm_Chr5g0053181 RchiOBHm_Chr5g0053191 RchiOBHm_Chr5g0053201 RchiOBHm_Chr5g0053211 RchiOBHm_Chr5g0053221 RchiOBHm_Chr5g0053231 RchiOBHm_Chr5g0053241 RchiOBHm_Chr5g0053251 RchiOBHm_Chr5g0053271 RchiOBHm_Chr5g0053391 RchiOBHm_Chr5g0053401 RchiOBHm_Chr5g0053411 RchiOBHm_Chr5g0069271 RchiOBHm_Chr5g0069281 RchiOBHm_Chr5g0069291 RchiOBHm_Chr5g0069301
rosa_multiflora Rmu_sc0000684.1_g000009 Rmu_sc0001966.1_g000053
rosa_roxburghii Rroxscaffold_1G00000190 Rroxscaffold_1G00000200 Rroxscaffold_1G00000210 Rroxscaffold_1G00000220 Rroxscaffold_1G00028850 Rroxscaffold_1G00028890 Rroxscaffold_1G00028910 Rroxscaffold_5G00356310 Rroxscaffold_6G00392770 Rroxscaffold_7G00200870
rosa_samantha Rh5DG331800 Rh5DG331900 Rh5DG332000 Rh5DG332100 Rh5DG332200 Rh5DG362400 Rh5DG362500 Rh5DG362600 Rh5DG362700 Rh5DG362800 Rh5DG362900 Rh5DG363000 Rh5DG363100 Rh5DG363200 Rh5DG363300 Rh5DG363400 Rh5DG363500 Rh5DG363600 Rh5DG363700 Rh5DG363800 Rh5DG365100 Rh5DG365200 Rh5DG365300 Rh5DG365400 Rh5DG365500 Rh5DG365600 Rh5DG365700 Rh5DG365800 Rh5DG365900 Rh5DG366000 Rh5DG366100 Rh5DG366200 Rh5DG366300 Rh5DG366400 Rh5DG366500 Rh5DG366600 Rh5DG366700 Rh5DG366800 Rh5DG366900 Rh5DG367000 Rh5DG367100 Rh5DG367200 Rh5DG367300 Rh5DG367400 Rh5DG367500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 274
AcuI CTGAAG 1 cut(s) 111
AflIII ACRYGT 1 cut(s) 309
AgsI TTSAA 2 cut(s) 148, 295
AjiI CACGTC 1 cut(s) 310
AluBI AGCT 4 cut(s) 15, 47, 89, 267
AluI AGCT 4 cut(s) 15, 47, 89, 267
Alw26I GTCTC 1 cut(s) 331
AoxI GGCC 1 cut(s) 274
AspLEI GCGC 1 cut(s) 31
BceAI ACGGC 1 cut(s) 261
BcoDI GTCTC 1 cut(s) 331
BfaI CTAG 1 cut(s) 119
BlpI GCTNAGC 1 cut(s) 11
BmgBI CACGTC 1 cut(s) 310
BmiI GGNNCC 1 cut(s) 178
Bpu1102I GCTNAGC 1 cut(s) 11
BsaXI ACNNNNNCTCC 2 cut(s) 307, 337
BseGI GGATG 1 cut(s) 310
BshFI GGCC 1 cut(s) 276
BsmAI GTCTC 1 cut(s) 331
BsnI GGCC 1 cut(s) 276
Bsp1720I GCTNAGC 1 cut(s) 11
BspANI GGCC 1 cut(s) 276
BspLI GGNNCC 1 cut(s) 178
Bst4CI ACNGT 1 cut(s) 323
Bst6I CTCTTC 1 cut(s) 293
BstDEI CTNAG 1 cut(s) 11
BstF5I GGATG 1 cut(s) 310
BstHHI GCGC 1 cut(s) 31
BstMAI GTCTC 1 cut(s) 331
BstMWI GCNNNNNNNGC 1 cut(s) 273
BsuRI GGCC 1 cut(s) 276
BtrI CACGTC 1 cut(s) 310
BtsCI GGATG 1 cut(s) 310
BtsIMutI CAGTG 1 cut(s) 319
CfoI GCGC 1 cut(s) 31
CviAII CATG 2 cut(s) 20, 230
CviJI RGCY 6 cut(s) 10, 15, 47, 89, 267, 276
CviKI_1 RGCY 6 cut(s) 10, 15, 47, 89, 267, 276
DdeI CTNAG 1 cut(s) 11
EaeI YGGCCR 1 cut(s) 274
Eam1104I CTCTTC 1 cut(s) 293
EarI CTCTTC 1 cut(s) 293
Eco57I CTGAAG 1 cut(s) 111
FaeI CATG 2 cut(s) 23, 233
FaiI YATR 6 cut(s) 21, 106, 152, 159, 231, 249
FatI CATG 2 cut(s) 19, 229
FokI GGATG 1 cut(s) 317
FspBI CTAG 1 cut(s) 119
GlaI GCGC 1 cut(s) 30
HaeIII GGCC 1 cut(s) 276
HhaI GCGC 1 cut(s) 31
Hin1II CATG 2 cut(s) 23, 233
Hin6I GCGC 1 cut(s) 29
HinP1I GCGC 1 cut(s) 29
HindIII AAGCTT 1 cut(s) 265
HinfI GANTC 2 cut(s) 188, 316
HpyAV CCTTC 1 cut(s) 209
HpyCH4III ACNGT 1 cut(s) 323
HpyCH4IV ACGT 1 cut(s) 309
HpyCH4V TGCA 1 cut(s) 143
HpyF10VI GCNNNNNNNGC 1 cut(s) 273
HpyF3I CTNAG 1 cut(s) 11
HpySE526I ACGT 1 cut(s) 309
Hsp92II CATG 2 cut(s) 23, 233
HspAI GCGC 1 cut(s) 29
LmnI GCTCC 1 cut(s) 20
LpnPI CCDG 1 cut(s) 81
MaeI CTAG 1 cut(s) 119
MaeII ACGT 1 cut(s) 309
MaeIII GTNAC 1 cut(s) 317
MboII GAAGA 3 cut(s) 95, 307, 310
MluCI AATT 3 cut(s) 153, 270, 330
MlyI GAGTC 2 cut(s) 197, 325
MnlI CCTC 2 cut(s) 191, 294
MseI TTAA 4 cut(s) 123, 243, 269, 346
MwoI GCNNNNNNNGC 1 cut(s) 273
NlaIII CATG 2 cut(s) 23, 233
NlaIV GGNNCC 1 cut(s) 178
NmuCI GTSAC 1 cut(s) 317
PflFI GACNNNGTC 1 cut(s) 206
PleI GAGTC 2 cut(s) 196, 324
PpsI GAGTC 2 cut(s) 196, 324
PspN4I GGNNCC 1 cut(s) 178
PsyI GACNNNGTC 1 cut(s) 206
SaqAI TTAA 4 cut(s) 123, 243, 269, 346
SchI GAGTC 2 cut(s) 197, 325
SetI ASST 6 cut(s) 17, 49, 91, 207, 269, 312
Sse9I AATT 3 cut(s) 153, 270, 330
SspMI CTAG 1 cut(s) 119
TaaI ACNGT 1 cut(s) 323
TaiI ACGT 1 cut(s) 312
TaqI TCGA 1 cut(s) 81
TasI AATT 3 cut(s) 153, 270, 330
Tru1I TTAA 4 cut(s) 123, 243, 269, 346
Tru9I TTAA 4 cut(s) 123, 243, 269, 346
TscAI CASTG 1 cut(s) 326
TseFI GTSAC 1 cut(s) 317
Tsp45I GTSAC 1 cut(s) 317
TspDTI ATGAA 1 cut(s) 25
TspRI CASTG 1 cut(s) 326
Tth111I GACNNNGTC 1 cut(s) 206
XspI CTAG 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.