AT5G34908

Encoded by

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0000266
Physical Location & Seq
Forward (+)
13225067 .. 13225315
249 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G34908.1

Sequence Viewer

Length: 249 bp
ATGGCTAAATTTAACTCTCAGATTACTACGCTATTCATTGTTGTAGCTTTGGTGTGTGCATTTGTTCCAGCTTTCTCAGTCGAAAAAGCTGAAGCAAATTTATTGTGGAATAATTGTCTTGTTAAAATCACTCCTAAGTGTGCGTTAGATATAATTGCTGCTGTCTTCGAAAATGGAACAATGTCTGATCCTTGTTTGCAGAGATTACTTAGAGATATAAGCTACTCATCGAGTGTTTGTAGAGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Prolamin_like

Protein Analysis

82

Amino Acids

9.03

Weight (kDa)

6.12

Isoelectric Point (pI)

37.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000266)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G45215 AT1G45221 AT1G45223 AT1G57760 AT1G57775 AT1G57777 AT3G30383 AT3G30385 AT3G30387 AT3G44115 AT4G07515 AT4G08025 AT5G34881 AT5G34882 AT5G34883 AT5G34885 AT5G34887 AT5G34905 AT5G34908 AT5G42567 AT5G42955 AT5G42957
prunus_persica Prupe.2G072700_v2.0.a1 Prupe.2G086700_v2.0.a1 Prupe.2G086800_v2.0.a1 Prupe.2G086900_v2.0.a1 Prupe.2G101000_v2.0.a1 Prupe.4G143200_v2.0.a1 Prupe.6G084400_v2.0.a1 Prupe.6G170500_v2.0.a1 Prupe.6G170600_v2.0.a1 Prupe.6G170700_v2.0.a1 Prupe.6G170800_v2.0.a1 Prupe.6G171000_v2.0.a1 Prupe.6G171100_v2.0.a1 Prupe.6G171200_v2.0.a1 Prupe.6G171300_v2.0.a1 Prupe.6G171400_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0046951 RchiOBHm_Chr5g0046961 RchiOBHm_Chr5g0046971 RchiOBHm_Chr5g0051281 RchiOBHm_Chr5g0051291 RchiOBHm_Chr5g0051301 RchiOBHm_Chr5g0051311 RchiOBHm_Chr5g0051321 RchiOBHm_Chr5g0051331 RchiOBHm_Chr5g0051341 RchiOBHm_Chr5g0051391 RchiOBHm_Chr5g0051401 RchiOBHm_Chr5g0051411 RchiOBHm_Chr5g0051421 RchiOBHm_Chr5g0053111 RchiOBHm_Chr5g0053121 RchiOBHm_Chr5g0053141 RchiOBHm_Chr5g0053151 RchiOBHm_Chr5g0053161 RchiOBHm_Chr5g0053171 RchiOBHm_Chr5g0053181 RchiOBHm_Chr5g0053191 RchiOBHm_Chr5g0053201 RchiOBHm_Chr5g0053211 RchiOBHm_Chr5g0053221 RchiOBHm_Chr5g0053231 RchiOBHm_Chr5g0053241 RchiOBHm_Chr5g0053251 RchiOBHm_Chr5g0053271 RchiOBHm_Chr5g0053391 RchiOBHm_Chr5g0053401 RchiOBHm_Chr5g0053411 RchiOBHm_Chr5g0069271 RchiOBHm_Chr5g0069281 RchiOBHm_Chr5g0069291 RchiOBHm_Chr5g0069301
rosa_multiflora Rmu_sc0000684.1_g000009 Rmu_sc0001966.1_g000053
rosa_roxburghii Rroxscaffold_1G00000190 Rroxscaffold_1G00000200 Rroxscaffold_1G00000210 Rroxscaffold_1G00000220 Rroxscaffold_1G00028850 Rroxscaffold_1G00028890 Rroxscaffold_1G00028910 Rroxscaffold_5G00356310 Rroxscaffold_6G00392770 Rroxscaffold_7G00200870
rosa_samantha Rh5DG331800 Rh5DG331900 Rh5DG332000 Rh5DG332100 Rh5DG332200 Rh5DG362400 Rh5DG362500 Rh5DG362600 Rh5DG362700 Rh5DG362800 Rh5DG362900 Rh5DG363000 Rh5DG363100 Rh5DG363200 Rh5DG363300 Rh5DG363400 Rh5DG363500 Rh5DG363600 Rh5DG363700 Rh5DG363800 Rh5DG365100 Rh5DG365200 Rh5DG365300 Rh5DG365400 Rh5DG365500 Rh5DG365600 Rh5DG365700 Rh5DG365800 Rh5DG365900 Rh5DG366000 Rh5DG366100 Rh5DG366200 Rh5DG366300 Rh5DG366400 Rh5DG366500 Rh5DG366600 Rh5DG366700 Rh5DG366800 Rh5DG366900 Rh5DG367000 Rh5DG367100 Rh5DG367200 Rh5DG367300 Rh5DG367400 Rh5DG367500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 182
AcsI RAATTY 2 cut(s) 8, 97
AcuI CTGAAG 1 cut(s) 111
AluBI AGCT 4 cut(s) 47, 71, 89, 222
AluI AGCT 4 cut(s) 47, 71, 89, 222
AlwI GGATC 1 cut(s) 182
ApeKI GCWGC 1 cut(s) 158
ApoI RAATTY 2 cut(s) 8, 97
AsuII TTCGAA 1 cut(s) 168
BbsI GAAGAC 1 cut(s) 157
BbvI GCAGC 1 cut(s) 145
BisI GCNGC 1 cut(s) 159
BlsI GCNGC 1 cut(s) 160
BpiI GAAGAC 1 cut(s) 157
Bpu14I TTCGAA 1 cut(s) 168
BseMII CTCAG 2 cut(s) 32, 90
BseXI GCAGC 1 cut(s) 145
Bsp119I TTCGAA 1 cut(s) 168
Bsp143I GATC 1 cut(s) 187
BspCNI CTCAG 2 cut(s) 31, 89
BspPI GGATC 1 cut(s) 182
BspT104I TTCGAA 1 cut(s) 168
BssMI GATC 1 cut(s) 187
BstBI TTCGAA 1 cut(s) 168
BstDEI CTNAG 4 cut(s) 18, 76, 135, 209
BstKTI GATC 1 cut(s) 190
BstMBI GATC 1 cut(s) 187
BstV1I GCAGC 1 cut(s) 145
BstV2I GAAGAC 1 cut(s) 157
CviJI RGCY 5 cut(s) 5, 47, 71, 89, 222
CviKI_1 RGCY 5 cut(s) 5, 47, 71, 89, 222
DdeI CTNAG 4 cut(s) 18, 76, 135, 209
DpnI GATC 1 cut(s) 189
DpnII GATC 1 cut(s) 187
Eco57I CTGAAG 1 cut(s) 111
FaiI YATR 2 cut(s) 152, 218
Fnu4HI GCNGC 1 cut(s) 159
Fsp4HI GCNGC 1 cut(s) 159
FspEI CC 6 cut(s) 35, 81, 91, 147, 159, 204
GluI GCNGC 1 cut(s) 159
Hpy188I TCNGA 2 cut(s) 21, 187
HpyCH4V TGCA 2 cut(s) 59, 199
HpyF3I CTNAG 4 cut(s) 18, 76, 135, 209
Kzo9I GATC 1 cut(s) 187
LpnPI CCDG 1 cut(s) 81
Lsp1109I GCAGC 1 cut(s) 145
MalI GATC 1 cut(s) 189
MboI GATC 1 cut(s) 187
MboII GAAGA 1 cut(s) 157
MluCI AATT 4 cut(s) 8, 97, 112, 153
MseI TTAA 2 cut(s) 12, 123
NdeII GATC 1 cut(s) 187
NspV TTCGAA 1 cut(s) 168
PkrI GCNGC 1 cut(s) 160
SaqAI TTAA 2 cut(s) 12, 123
SatI GCNGC 1 cut(s) 159
Sau3AI GATC 1 cut(s) 187
SetI ASST 4 cut(s) 49, 73, 91, 224
SfuI TTCGAA 1 cut(s) 168
SgeI CNNG 4 cut(s) 80, 131, 204, 243
Sse9I AATT 4 cut(s) 8, 97, 112, 153
TaqI TCGA 3 cut(s) 81, 168, 230
TasI AATT 4 cut(s) 8, 97, 112, 153
Tru1I TTAA 2 cut(s) 12, 123
Tru9I TTAA 2 cut(s) 12, 123
TseI GCWGC 1 cut(s) 158
TspDTI ATGAA 1 cut(s) 25
XapI RAATTY 2 cut(s) 8, 97
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.