AT5G34883

Encoded by

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Forward (+)
13199562 .. 13199945
384 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G34883.1

Sequence Viewer

Length: 348 bp
ATGGCTAGATTTAACTCTCAGATTACTACGCTATTCATTGTTGTAGCTTTGGTGTGTGCATTTGTTCCAACTTTCTCAGTCAAAGAAGCTGAAGCAAATTTATTATGGAATACTTGTCTTGTTAAATTCACTCCTAAGTGTGCGTTAGATATAATTGCTGCTGTCTTCGAAAATGGAACAATGCCTGATCCTTGTTGCAACGATCTTGTCAAAGAAGGAAAAGTGTGTCACGATTCGCTTATTAAATATATTGCAGATAAACCCATGTTAATTGCTCACGAAACAGAATACTTAAAGAAGAGTGATGACTTGTGGAAACATTGTGTCTCAATCTCCAAAAGTGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

115

Amino Acids

12.81

Weight (kDa)

6.26

Isoelectric Point (pI)

19.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Prolamin_like PF05617 38 - 109 3.9e-14 Prolamin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000266)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G45215 AT1G45221 AT1G45223 AT1G57760 AT1G57775 AT1G57777 AT3G30383 AT3G30385 AT3G30387 AT3G44115 AT4G07515 AT4G08025 AT5G34881 AT5G34882 AT5G34883 AT5G34885 AT5G34887 AT5G34905 AT5G34908 AT5G42567 AT5G42955 AT5G42957
prunus_persica Prupe.2G072700_v2.0.a1 Prupe.2G086700_v2.0.a1 Prupe.2G086800_v2.0.a1 Prupe.2G086900_v2.0.a1 Prupe.2G101000_v2.0.a1 Prupe.4G143200_v2.0.a1 Prupe.6G084400_v2.0.a1 Prupe.6G170500_v2.0.a1 Prupe.6G170600_v2.0.a1 Prupe.6G170700_v2.0.a1 Prupe.6G170800_v2.0.a1 Prupe.6G171000_v2.0.a1 Prupe.6G171100_v2.0.a1 Prupe.6G171200_v2.0.a1 Prupe.6G171300_v2.0.a1 Prupe.6G171400_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0046951 RchiOBHm_Chr5g0046961 RchiOBHm_Chr5g0046971 RchiOBHm_Chr5g0051281 RchiOBHm_Chr5g0051291 RchiOBHm_Chr5g0051301 RchiOBHm_Chr5g0051311 RchiOBHm_Chr5g0051321 RchiOBHm_Chr5g0051331 RchiOBHm_Chr5g0051341 RchiOBHm_Chr5g0051391 RchiOBHm_Chr5g0051401 RchiOBHm_Chr5g0051411 RchiOBHm_Chr5g0051421 RchiOBHm_Chr5g0053111 RchiOBHm_Chr5g0053121 RchiOBHm_Chr5g0053141 RchiOBHm_Chr5g0053151 RchiOBHm_Chr5g0053161 RchiOBHm_Chr5g0053171 RchiOBHm_Chr5g0053181 RchiOBHm_Chr5g0053191 RchiOBHm_Chr5g0053201 RchiOBHm_Chr5g0053211 RchiOBHm_Chr5g0053221 RchiOBHm_Chr5g0053231 RchiOBHm_Chr5g0053241 RchiOBHm_Chr5g0053251 RchiOBHm_Chr5g0053271 RchiOBHm_Chr5g0053391 RchiOBHm_Chr5g0053401 RchiOBHm_Chr5g0053411 RchiOBHm_Chr5g0069271 RchiOBHm_Chr5g0069281 RchiOBHm_Chr5g0069291 RchiOBHm_Chr5g0069301
rosa_multiflora Rmu_sc0000684.1_g000009 Rmu_sc0001966.1_g000053
rosa_roxburghii Rroxscaffold_1G00000190 Rroxscaffold_1G00000200 Rroxscaffold_1G00000210 Rroxscaffold_1G00000220 Rroxscaffold_1G00028850 Rroxscaffold_1G00028890 Rroxscaffold_1G00028910 Rroxscaffold_5G00356310 Rroxscaffold_6G00392770 Rroxscaffold_7G00200870
rosa_samantha Rh5DG331800 Rh5DG331900 Rh5DG332000 Rh5DG332100 Rh5DG332200 Rh5DG362400 Rh5DG362500 Rh5DG362600 Rh5DG362700 Rh5DG362800 Rh5DG362900 Rh5DG363000 Rh5DG363100 Rh5DG363200 Rh5DG363300 Rh5DG363400 Rh5DG363500 Rh5DG363600 Rh5DG363700 Rh5DG363800 Rh5DG365100 Rh5DG365200 Rh5DG365300 Rh5DG365400 Rh5DG365500 Rh5DG365600 Rh5DG365700 Rh5DG365800 Rh5DG365900 Rh5DG366000 Rh5DG366100 Rh5DG366200 Rh5DG366300 Rh5DG366400 Rh5DG366500 Rh5DG366600 Rh5DG366700 Rh5DG366800 Rh5DG366900 Rh5DG367000 Rh5DG367100 Rh5DG367200 Rh5DG367300 Rh5DG367400 Rh5DG367500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 182
AcsI RAATTY 2 cut(s) 97, 125
AcuI CTGAAG 1 cut(s) 111
AluBI AGCT 2 cut(s) 47, 89
AluI AGCT 2 cut(s) 47, 89
Alw26I GTCTC 1 cut(s) 331
AlwI GGATC 1 cut(s) 182
ApeKI GCWGC 1 cut(s) 158
ApoI RAATTY 2 cut(s) 97, 125
AsuII TTCGAA 1 cut(s) 168
BbsI GAAGAC 1 cut(s) 157
BbvI GCAGC 1 cut(s) 145
BcoDI GTCTC 1 cut(s) 331
BfaI CTAG 1 cut(s) 6
BisI GCNGC 1 cut(s) 159
BlsI GCNGC 1 cut(s) 160
BpiI GAAGAC 1 cut(s) 157
Bpu14I TTCGAA 1 cut(s) 168
BseMII CTCAG 2 cut(s) 32, 90
BseXI GCAGC 1 cut(s) 145
BsmAI GTCTC 1 cut(s) 331
Bsp119I TTCGAA 1 cut(s) 168
Bsp143I GATC 2 cut(s) 187, 202
BspCNI CTCAG 2 cut(s) 31, 89
BspPI GGATC 1 cut(s) 182
BspT104I TTCGAA 1 cut(s) 168
BssMI GATC 2 cut(s) 187, 202
Bst6I CTCTTC 1 cut(s) 293
BstBI TTCGAA 1 cut(s) 168
BstDEI CTNAG 3 cut(s) 18, 76, 135
BstKTI GATC 2 cut(s) 190, 205
BstMAI GTCTC 1 cut(s) 331
BstMBI GATC 2 cut(s) 187, 202
BstV1I GCAGC 1 cut(s) 145
BstV2I GAAGAC 1 cut(s) 157
CviAII CATG 1 cut(s) 265
CviJI RGCY 3 cut(s) 5, 47, 89
CviKI_1 RGCY 3 cut(s) 5, 47, 89
DdeI CTNAG 3 cut(s) 18, 76, 135
DpnI GATC 2 cut(s) 189, 204
DpnII GATC 2 cut(s) 187, 202
Eam1104I CTCTTC 1 cut(s) 293
EarI CTCTTC 1 cut(s) 293
Eco57I CTGAAG 1 cut(s) 111
FaeI CATG 1 cut(s) 268
FaiI YATR 4 cut(s) 106, 152, 249, 266
FatI CATG 1 cut(s) 264
Fnu4HI GCNGC 1 cut(s) 159
Fsp4HI GCNGC 1 cut(s) 159
FspBI CTAG 1 cut(s) 6
GluI GCNGC 1 cut(s) 159
Hin1II CATG 1 cut(s) 268
HinfI GANTC 1 cut(s) 233
Hpy188I TCNGA 1 cut(s) 21
Hpy188III TCNNGA 2 cut(s) 230, 278
HpyAV CCTTC 1 cut(s) 209
HpyCH4V TGCA 3 cut(s) 59, 198, 254
HpyF3I CTNAG 3 cut(s) 18, 76, 135
Hsp92II CATG 1 cut(s) 268
Kzo9I GATC 2 cut(s) 187, 202
LpnPI CCDG 1 cut(s) 198
Lsp1109I GCAGC 1 cut(s) 145
MaeI CTAG 1 cut(s) 6
MaeIII GTNAC 1 cut(s) 227
MalI GATC 2 cut(s) 189, 204
MboI GATC 2 cut(s) 187, 202
MboII GAAGA 2 cut(s) 157, 310
MluCI AATT 4 cut(s) 97, 125, 153, 270
MmeI TCCRAC 1 cut(s) 92
MseI TTAA 5 cut(s) 12, 123, 243, 269, 293
NdeII GATC 2 cut(s) 187, 202
NlaIII CATG 1 cut(s) 268
NmuCI GTSAC 1 cut(s) 227
NspV TTCGAA 1 cut(s) 168
PfeI GAWTC 1 cut(s) 233
PkrI GCNGC 1 cut(s) 160
SaqAI TTAA 5 cut(s) 12, 123, 243, 269, 293
SatI GCNGC 1 cut(s) 159
Sau3AI GATC 2 cut(s) 187, 202
SetI ASST 2 cut(s) 49, 91
SfuI TTCGAA 1 cut(s) 168
Sse9I AATT 4 cut(s) 97, 125, 153, 270
SspMI CTAG 1 cut(s) 6
TaqI TCGA 1 cut(s) 168
TasI AATT 4 cut(s) 97, 125, 153, 270
TfiI GAWTC 1 cut(s) 233
Tru1I TTAA 5 cut(s) 12, 123, 243, 269, 293
Tru9I TTAA 5 cut(s) 12, 123, 243, 269, 293
TseFI GTSAC 1 cut(s) 227
TseI GCWGC 1 cut(s) 158
Tsp45I GTSAC 1 cut(s) 227
TspDTI ATGAA 1 cut(s) 25
XapI RAATTY 2 cut(s) 97, 125
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.