Rroxscaffold_7G00200870

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0000266
Physical Location & Seq
Reverse (-)
48341159 .. 48341377
219 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00200870.1

Sequence Viewer

Length: 219 bp
ATGGAGCAGGAGAAGGAGAAAGAGGCCGTGGAGGATCTGCAGCGCTTGCCGAAAAGAGGCTGCCGCTTTGTTGTTCCGCCACCGTCACCATCACTCTCCCCACGTTCAACGACCTCGCCGCCGATTCCCAACTGTCCAATGCGTCACTATCACGGCGCAAAGCACCCTAACGTCACCGAGAAAATCACAGCTGCCGGACAAGAAGCTCCTCCGAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

7.94

Weight (kDa)

8.74

Isoelectric Point (pI)

86.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000266)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G45215 AT1G45221 AT1G45223 AT1G57760 AT1G57775 AT1G57777 AT3G30383 AT3G30385 AT3G30387 AT3G44115 AT4G07515 AT4G08025 AT5G34881 AT5G34882 AT5G34883 AT5G34885 AT5G34887 AT5G34905 AT5G34908 AT5G42567 AT5G42955 AT5G42957
prunus_persica Prupe.2G072700_v2.0.a1 Prupe.2G086700_v2.0.a1 Prupe.2G086800_v2.0.a1 Prupe.2G086900_v2.0.a1 Prupe.2G101000_v2.0.a1 Prupe.4G143200_v2.0.a1 Prupe.6G084400_v2.0.a1 Prupe.6G170500_v2.0.a1 Prupe.6G170600_v2.0.a1 Prupe.6G170700_v2.0.a1 Prupe.6G170800_v2.0.a1 Prupe.6G171000_v2.0.a1 Prupe.6G171100_v2.0.a1 Prupe.6G171200_v2.0.a1 Prupe.6G171300_v2.0.a1 Prupe.6G171400_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0046951 RchiOBHm_Chr5g0046961 RchiOBHm_Chr5g0046971 RchiOBHm_Chr5g0051281 RchiOBHm_Chr5g0051291 RchiOBHm_Chr5g0051301 RchiOBHm_Chr5g0051311 RchiOBHm_Chr5g0051321 RchiOBHm_Chr5g0051331 RchiOBHm_Chr5g0051341 RchiOBHm_Chr5g0051391 RchiOBHm_Chr5g0051401 RchiOBHm_Chr5g0051411 RchiOBHm_Chr5g0051421 RchiOBHm_Chr5g0053111 RchiOBHm_Chr5g0053121 RchiOBHm_Chr5g0053141 RchiOBHm_Chr5g0053151 RchiOBHm_Chr5g0053161 RchiOBHm_Chr5g0053171 RchiOBHm_Chr5g0053181 RchiOBHm_Chr5g0053191 RchiOBHm_Chr5g0053201 RchiOBHm_Chr5g0053211 RchiOBHm_Chr5g0053221 RchiOBHm_Chr5g0053231 RchiOBHm_Chr5g0053241 RchiOBHm_Chr5g0053251 RchiOBHm_Chr5g0053271 RchiOBHm_Chr5g0053391 RchiOBHm_Chr5g0053401 RchiOBHm_Chr5g0053411 RchiOBHm_Chr5g0069271 RchiOBHm_Chr5g0069281 RchiOBHm_Chr5g0069291 RchiOBHm_Chr5g0069301
rosa_multiflora Rmu_sc0000684.1_g000009 Rmu_sc0001966.1_g000053
rosa_roxburghii Rroxscaffold_1G00000190 Rroxscaffold_1G00000200 Rroxscaffold_1G00000210 Rroxscaffold_1G00000220 Rroxscaffold_1G00028850 Rroxscaffold_1G00028890 Rroxscaffold_1G00028910 Rroxscaffold_5G00356310 Rroxscaffold_6G00392770 Rroxscaffold_7G00200870
rosa_samantha Rh5DG331800 Rh5DG331900 Rh5DG332000 Rh5DG332100 Rh5DG332200 Rh5DG362400 Rh5DG362500 Rh5DG362600 Rh5DG362700 Rh5DG362800 Rh5DG362900 Rh5DG363000 Rh5DG363100 Rh5DG363200 Rh5DG363300 Rh5DG363400 Rh5DG363500 Rh5DG363600 Rh5DG363700 Rh5DG363800 Rh5DG365100 Rh5DG365200 Rh5DG365300 Rh5DG365400 Rh5DG365500 Rh5DG365600 Rh5DG365700 Rh5DG365800 Rh5DG365900 Rh5DG366000 Rh5DG366100 Rh5DG366200 Rh5DG366300 Rh5DG366400 Rh5DG366500 Rh5DG366600 Rh5DG366700 Rh5DG366800 Rh5DG366900 Rh5DG367000 Rh5DG367100 Rh5DG367200 Rh5DG367300 Rh5DG367400 Rh5DG367500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 64, 77, 119
AclWI GGATC 1 cut(s) 42
AfeI AGCGCT 1 cut(s) 44
AfiI CCNNNNNNNGG 1 cut(s) 56
AgsI TTSAA 1 cut(s) 108
AluBI AGCT 3 cut(s) 191, 206, 216
AluI AGCT 3 cut(s) 191, 206, 216
AlwI GGATC 1 cut(s) 42
Aor51HI AGCGCT 1 cut(s) 44
AoxI GGCC 1 cut(s) 24
ApeKI GCWGC 3 cut(s) 40, 60, 191
AspLEI GCGC 2 cut(s) 45, 158
AsuHPI GGTGA 2 cut(s) 78, 166
BbvI GCAGC 3 cut(s) 47, 52, 178
BccI CCATC 1 cut(s) 97
BceAI ACGGC 2 cut(s) 11, 169
BfmI CTRYAG 1 cut(s) 38
BfoI RGCGCY 1 cut(s) 46
BisI GCNGC 5 cut(s) 41, 61, 64, 119, 192
BlsI GCNGC 5 cut(s) 42, 62, 65, 120, 193
BsaJI CCNNGG 1 cut(s) 27
Bsc4I CCNNNNNNNGG 1 cut(s) 56
BseDI CCNNGG 1 cut(s) 27
BseLI CCNNNNNNNGG 1 cut(s) 56
BseRI GAGGAG 1 cut(s) 198
BseXI GCAGC 3 cut(s) 47, 52, 178
BshFI GGCC 1 cut(s) 26
BsiSI CCGG 1 cut(s) 195
BslI CCNNNNNNNGG 1 cut(s) 56
BsnI GGCC 1 cut(s) 26
Bsp143I GATC 1 cut(s) 34
BspACI CCGC 3 cut(s) 64, 77, 119
BspANI GGCC 1 cut(s) 26
BspMAI CTGCAG 1 cut(s) 42
BspPI GGATC 1 cut(s) 42
BssECI CCNNGG 1 cut(s) 27
BssMI GATC 1 cut(s) 34
Bst4CI ACNGT 2 cut(s) 84, 134
BstAPI GCANNNNNTGC 1 cut(s) 46
BstC8I GCNNGC 1 cut(s) 47
BstDSI CCRYGG 1 cut(s) 27
BstH2I RGCGCY 1 cut(s) 46
BstHHI GCGC 2 cut(s) 45, 158
BstKTI GATC 1 cut(s) 37
BstMBI GATC 1 cut(s) 34
BstMWI GCNNNNNNNGC 1 cut(s) 46
BstSFI CTRYAG 1 cut(s) 38
BstV1I GCAGC 3 cut(s) 47, 52, 178
BstX2I RGATCY 1 cut(s) 34
BstYI RGATCY 1 cut(s) 34
BsuRI GGCC 1 cut(s) 26
BtgI CCRYGG 1 cut(s) 27
Cac8I GCNNGC 1 cut(s) 47
CfoI GCGC 2 cut(s) 45, 158
CseI GACGC 1 cut(s) 131
CviJI RGCY 5 cut(s) 26, 60, 191, 206, 216
CviKI_1 RGCY 5 cut(s) 26, 60, 191, 206, 216
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
EciI GGCGGA 1 cut(s) 66
Eco47III AGCGCT 1 cut(s) 44
Fnu4HI GCNGC 5 cut(s) 41, 61, 64, 119, 192
Fsp4HI GCNGC 5 cut(s) 41, 61, 64, 119, 192
GlaI GCGC 2 cut(s) 44, 157
GluI GCNGC 5 cut(s) 41, 61, 64, 119, 192
HaeII RGCGCY 1 cut(s) 46
HaeIII GGCC 1 cut(s) 26
HapII CCGG 1 cut(s) 195
HgaI GACGC 1 cut(s) 131
HhaI GCGC 2 cut(s) 45, 158
Hin6I GCGC 2 cut(s) 43, 156
HinP1I GCGC 2 cut(s) 43, 156
HinfI GANTC 1 cut(s) 124
HpaII CCGG 1 cut(s) 195
HphI GGTGA 2 cut(s) 78, 166
Hpy188I TCNGA 1 cut(s) 213
HpyAV CCTTC 1 cut(s) 7
HpyCH4III ACNGT 2 cut(s) 84, 134
HpyCH4IV ACGT 2 cut(s) 103, 171
HpyCH4V TGCA 1 cut(s) 40
HpyF10VI GCNNNNNNNGC 1 cut(s) 46
HpySE526I ACGT 2 cut(s) 103, 171
HspAI GCGC 2 cut(s) 43, 156
Kzo9I GATC 1 cut(s) 34
LmnI GCTCC 2 cut(s) 4, 211
LpnPI CCDG 1 cut(s) 208
Lsp1109I GCAGC 3 cut(s) 47, 52, 178
MaeII ACGT 2 cut(s) 103, 171
MaeIII GTNAC 3 cut(s) 84, 143, 172
MalI GATC 1 cut(s) 36
MboI GATC 1 cut(s) 34
MflI RGATCY 1 cut(s) 34
MnlI CCTC 5 cut(s) 16, 25, 50, 124, 219
MspA1I CMGCKG 1 cut(s) 191
MspI CCGG 1 cut(s) 195
MwoI GCNNNNNNNGC 1 cut(s) 46
NdeII GATC 1 cut(s) 34
NmuCI GTSAC 3 cut(s) 84, 143, 172
PfeI GAWTC 1 cut(s) 124
PkrI GCNGC 5 cut(s) 42, 62, 65, 120, 193
PstI CTGCAG 1 cut(s) 42
PsuI RGATCY 1 cut(s) 34
PvuII CAGCTG 1 cut(s) 191
SatI GCNGC 5 cut(s) 41, 61, 64, 119, 192
Sau3AI GATC 1 cut(s) 34
SetI ASST 6 cut(s) 106, 116, 174, 193, 208, 218
SfcI CTRYAG 1 cut(s) 38
SgeI CNNG 9 cut(s) 20, 40, 58, 114, 127, 164, 190, 207, 212
SsiI CCGC 3 cut(s) 64, 77, 119
TaaI ACNGT 2 cut(s) 84, 134
TaiI ACGT 2 cut(s) 106, 174
TauI GCSGC 2 cut(s) 66, 121
TfiI GAWTC 1 cut(s) 124
TseFI GTSAC 3 cut(s) 84, 143, 172
TseI GCWGC 3 cut(s) 40, 60, 191
Tsp45I GTSAC 3 cut(s) 84, 143, 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.