Prupe.6G171300_v2.0.a1

Prolamin-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
OG0000266
Physical Location & Seq
Reverse (-)
17622378 .. 17622722
345 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G171300.1

Sequence Viewer

Length: 345 bp
ATGGCAAGGTTCATTGGTTATCAAACTTCTGTAATCTTGATTTTTGTGATTACAACAATGATGATTTTGCCAGGACTTGCAACCCTAGCACCCTCCCCATCAAATTTTATGTTCTTAGAGGAATGCAAATCAAGGCTTCATGCTAGGTGTGGAAAAGAAATATTCATTACAATAATTAAGGAATGGTCTATTAGTGATAGGTGTTGCATGGAGTTTGTATCAATGGGTCAACCATGCCATTTTGCATTAGTGAACAAAGCTCTTTCAGGCCCTCTTTCCAAATTAAACAAGTCGGATGCTTTGACCAAGAGTGTAGAAATTTGGAATCACTACTACAAAAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Prolamin_like

Protein Analysis

115

Amino Acids

12.94

Weight (kDa)

9.08

Isoelectric Point (pI)

46.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000266)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G45215 AT1G45221 AT1G45223 AT1G57760 AT1G57775 AT1G57777 AT3G30383 AT3G30385 AT3G30387 AT3G44115 AT4G07515 AT4G08025 AT5G34881 AT5G34882 AT5G34883 AT5G34885 AT5G34887 AT5G34905 AT5G34908 AT5G42567 AT5G42955 AT5G42957
prunus_persica Prupe.2G072700_v2.0.a1 Prupe.2G086700_v2.0.a1 Prupe.2G086800_v2.0.a1 Prupe.2G086900_v2.0.a1 Prupe.2G101000_v2.0.a1 Prupe.4G143200_v2.0.a1 Prupe.6G084400_v2.0.a1 Prupe.6G170500_v2.0.a1 Prupe.6G170600_v2.0.a1 Prupe.6G170700_v2.0.a1 Prupe.6G170800_v2.0.a1 Prupe.6G171000_v2.0.a1 Prupe.6G171100_v2.0.a1 Prupe.6G171200_v2.0.a1 Prupe.6G171300_v2.0.a1 Prupe.6G171400_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0046951 RchiOBHm_Chr5g0046961 RchiOBHm_Chr5g0046971 RchiOBHm_Chr5g0051281 RchiOBHm_Chr5g0051291 RchiOBHm_Chr5g0051301 RchiOBHm_Chr5g0051311 RchiOBHm_Chr5g0051321 RchiOBHm_Chr5g0051331 RchiOBHm_Chr5g0051341 RchiOBHm_Chr5g0051391 RchiOBHm_Chr5g0051401 RchiOBHm_Chr5g0051411 RchiOBHm_Chr5g0051421 RchiOBHm_Chr5g0053111 RchiOBHm_Chr5g0053121 RchiOBHm_Chr5g0053141 RchiOBHm_Chr5g0053151 RchiOBHm_Chr5g0053161 RchiOBHm_Chr5g0053171 RchiOBHm_Chr5g0053181 RchiOBHm_Chr5g0053191 RchiOBHm_Chr5g0053201 RchiOBHm_Chr5g0053211 RchiOBHm_Chr5g0053221 RchiOBHm_Chr5g0053231 RchiOBHm_Chr5g0053241 RchiOBHm_Chr5g0053251 RchiOBHm_Chr5g0053271 RchiOBHm_Chr5g0053391 RchiOBHm_Chr5g0053401 RchiOBHm_Chr5g0053411 RchiOBHm_Chr5g0069271 RchiOBHm_Chr5g0069281 RchiOBHm_Chr5g0069291 RchiOBHm_Chr5g0069301
rosa_multiflora Rmu_sc0000684.1_g000009 Rmu_sc0001966.1_g000053
rosa_roxburghii Rroxscaffold_1G00000190 Rroxscaffold_1G00000200 Rroxscaffold_1G00000210 Rroxscaffold_1G00000220 Rroxscaffold_1G00028850 Rroxscaffold_1G00028890 Rroxscaffold_1G00028910 Rroxscaffold_5G00356310 Rroxscaffold_6G00392770 Rroxscaffold_7G00200870
rosa_samantha Rh5DG331800 Rh5DG331900 Rh5DG332000 Rh5DG332100 Rh5DG332200 Rh5DG362400 Rh5DG362500 Rh5DG362600 Rh5DG362700 Rh5DG362800 Rh5DG362900 Rh5DG363000 Rh5DG363100 Rh5DG363200 Rh5DG363300 Rh5DG363400 Rh5DG363500 Rh5DG363600 Rh5DG363700 Rh5DG363800 Rh5DG365100 Rh5DG365200 Rh5DG365300 Rh5DG365400 Rh5DG365500 Rh5DG365600 Rh5DG365700 Rh5DG365800 Rh5DG365900 Rh5DG366000 Rh5DG366100 Rh5DG366200 Rh5DG366300 Rh5DG366400 Rh5DG366500 Rh5DG366600 Rh5DG366700 Rh5DG366800 Rh5DG366900 Rh5DG367000 Rh5DG367100 Rh5DG367200 Rh5DG367300 Rh5DG367400 Rh5DG367500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 103, 318
AjnI CCWGG 1 cut(s) 70
AluBI AGCT 1 cut(s) 260
AluI AGCT 1 cut(s) 260
AoxI GGCC 1 cut(s) 268
ApoI RAATTY 2 cut(s) 103, 318
AspS9I GGNCC 1 cut(s) 269
BccI CCATC 1 cut(s) 106
BciT130I CCWGG 1 cut(s) 72
BfaI CTAG 2 cut(s) 86, 144
Bme1390I CCNGG 1 cut(s) 72
BmgT120I GGNCC 1 cut(s) 269
BmrFI CCNGG 1 cut(s) 72
BmsI GCATC 1 cut(s) 286
BseBI CCWGG 1 cut(s) 72
BseGI GGATG 1 cut(s) 301
BshFI GGCC 1 cut(s) 270
BsmI GAATGC 1 cut(s) 128
BsnI GGCC 1 cut(s) 270
BspANI GGCC 1 cut(s) 270
Bst2UI CCWGG 1 cut(s) 72
BstDEI CTNAG 1 cut(s) 115
BstF5I GGATG 1 cut(s) 301
BstMWI GCNNNNNNNGC 1 cut(s) 86
BstNI CCWGG 1 cut(s) 72
BstSCI CCNGG 1 cut(s) 70
BsuRI GGCC 1 cut(s) 270
BtsCI GGATG 1 cut(s) 301
Cfr13I GGNCC 1 cut(s) 269
CviAII CATG 3 cut(s) 140, 208, 234
CviJI RGCY 3 cut(s) 136, 260, 270
CviKI_1 RGCY 3 cut(s) 136, 260, 270
DdeI CTNAG 1 cut(s) 115
EcoO109I RGGNCCY 1 cut(s) 269
EcoRII CCWGG 1 cut(s) 70
FaeI CATG 3 cut(s) 143, 211, 237
FaiI YATR 4 cut(s) 110, 141, 209, 235
FatI CATG 3 cut(s) 139, 207, 233
FokI GGATG 1 cut(s) 308
FspBI CTAG 2 cut(s) 86, 144
HaeIII GGCC 1 cut(s) 270
Hin1II CATG 3 cut(s) 143, 211, 237
HincII GTYRAC 1 cut(s) 230
HindII GTYRAC 1 cut(s) 230
HinfI GANTC 1 cut(s) 325
Hpy166II GTNNAC 2 cut(s) 230, 253
Hpy188I TCNGA 1 cut(s) 295
Hpy188III TCNNGA 1 cut(s) 37
Hpy8I GTNNAC 2 cut(s) 230, 253
HpyCH4V TGCA 4 cut(s) 80, 126, 207, 245
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
HpyF3I CTNAG 1 cut(s) 115
Hsp92II CATG 3 cut(s) 143, 211, 237
LpnPI CCDG 3 cut(s) 57, 84, 252
LweI GCATC 1 cut(s) 286
MaeI CTAG 2 cut(s) 86, 144
MluCI AATT 4 cut(s) 103, 174, 281, 318
MmeI TCCRAC 1 cut(s) 273
MnlI CCTC 3 cut(s) 103, 112, 282
MseI TTAA 2 cut(s) 177, 284
MspR9I CCNGG 1 cut(s) 72
Mva1269I GAATGC 1 cut(s) 128
MvaI CCWGG 1 cut(s) 72
MwoI GCNNNNNNNGC 1 cut(s) 86
NlaIII CATG 3 cut(s) 143, 211, 237
PctI GAATGC 1 cut(s) 128
PfeI GAWTC 1 cut(s) 325
Psp6I CCWGG 1 cut(s) 70
PspGI CCWGG 1 cut(s) 70
PspPI GGNCC 1 cut(s) 269
SaqAI TTAA 2 cut(s) 177, 284
Sau96I GGNCC 1 cut(s) 269
ScrFI CCNGG 1 cut(s) 72
SetI ASST 4 cut(s) 11, 149, 203, 262
SfaNI GCATC 1 cut(s) 286
Sse9I AATT 4 cut(s) 103, 174, 281, 318
SspI AATATT 1 cut(s) 162
SspMI CTAG 2 cut(s) 86, 144
StyD4I CCNGG 1 cut(s) 70
TasI AATT 4 cut(s) 103, 174, 281, 318
TfiI GAWTC 1 cut(s) 325
Tru1I TTAA 2 cut(s) 177, 284
Tru9I TTAA 2 cut(s) 177, 284
TspDTI ATGAA 2 cut(s) 128, 154
XapI RAATTY 2 cut(s) 103, 318
XspI CTAG 2 cut(s) 86, 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.