AT1G47820

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Forward (+)
17611905 .. 17612613
709 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G47820.1

Sequence Viewer

Length: 291 bp
ATGGAGATTGAGAGTCACGTTTCAGTCCCTGGGAAGAATCTAGTTAAAGTAGAGTTCAAGCTTGGGACAGAGAGCTACACAATTGATTCAATCAAGGGTGATACTGTATTGGACCAATTGGTTTCGATGAAAGAAGAAAGTATGAAGATACTTAAGGATTTTATCACAAAGCATAATGTTCCAGATGATGATGTCCCTGACCAAATCTTGTCTGATGATGAAGAAGGTGATGATGATGATGCTTCTCCTGTAATATGTCCTGTGAAACCACCCAAGAAGACAAAGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

10.67

Weight (kDa)

4.45

Isoelectric Point (pI)

42.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflII CTTAAG 1 cut(s) 152
AgsI TTSAA 2 cut(s) 58, 90
AjnI CCWGG 1 cut(s) 28
AluBI AGCT 2 cut(s) 61, 75
AluI AGCT 2 cut(s) 61, 75
AlwNI CAGNNNCTG 1 cut(s) 29
AspS9I GGNCC 1 cut(s) 112
AsuHPI GGTGA 2 cut(s) 110, 239
AvaII GGWCC 1 cut(s) 112
BbsI GAAGAC 1 cut(s) 284
BciT130I CCWGG 1 cut(s) 30
BfaI CTAG 1 cut(s) 41
BfrI CTTAAG 1 cut(s) 152
Bme1390I CCNGG 1 cut(s) 30
Bme18I GGWCC 1 cut(s) 112
BmgT120I GGNCC 1 cut(s) 112
BmrFI CCNGG 1 cut(s) 30
BmsI GCATC 1 cut(s) 229
BpiI GAAGAC 1 cut(s) 284
BsaJI CCNNGG 2 cut(s) 28, 29
BseBI CCWGG 1 cut(s) 30
BseDI CCNNGG 2 cut(s) 28, 29
BslFI GGGAC 3 cut(s) 11, 79, 179
BsmFI GGGAC 3 cut(s) 11, 79, 179
BspTI CTTAAG 1 cut(s) 152
BssECI CCNNGG 2 cut(s) 28, 29
Bst2UI CCWGG 1 cut(s) 30
Bst4CI ACNGT 1 cut(s) 106
BstAFI CTTAAG 1 cut(s) 152
BstNI CCWGG 1 cut(s) 30
BstSCI CCNGG 1 cut(s) 28
BstV2I GAAGAC 1 cut(s) 284
CaiI CAGNNNCTG 1 cut(s) 29
Cfr13I GGNCC 1 cut(s) 112
CviJI RGCY 2 cut(s) 61, 75
CviKI_1 RGCY 2 cut(s) 61, 75
Eco47I GGWCC 1 cut(s) 112
EcoRII CCWGG 1 cut(s) 28
FaiI YATR 3 cut(s) 143, 174, 256
FaqI GGGAC 3 cut(s) 11, 79, 179
FspBI CTAG 1 cut(s) 41
HindIII AAGCTT 1 cut(s) 59
HinfI GANTC 3 cut(s) 13, 37, 86
HphI GGTGA 2 cut(s) 110, 239
Hpy188I TCNGA 1 cut(s) 214
Hpy188III TCNNGA 1 cut(s) 182
HpyAV CCTTC 1 cut(s) 218
HpyCH4III ACNGT 1 cut(s) 106
HpyCH4IV ACGT 1 cut(s) 18
HpySE526I ACGT 1 cut(s) 18
LpnPI CCDG 6 cut(s) 15, 42, 195, 210, 261, 273
LweI GCATC 1 cut(s) 229
MaeI CTAG 1 cut(s) 41
MaeII ACGT 1 cut(s) 18
MaeIII GTNAC 1 cut(s) 14
MboII GAAGA 5 cut(s) 46, 146, 157, 233, 289
MfeI CAATTG 2 cut(s) 81, 116
MluCI AATT 2 cut(s) 81, 116
MlyI GAGTC 1 cut(s) 22
MseI TTAA 2 cut(s) 45, 153
MspCI CTTAAG 1 cut(s) 152
MspR9I CCNGG 1 cut(s) 30
MunI CAATTG 2 cut(s) 81, 116
MvaI CCWGG 1 cut(s) 30
NmuCI GTSAC 1 cut(s) 14
PasI CCCWGGG 1 cut(s) 29
PfeI GAWTC 2 cut(s) 37, 86
PleI GAGTC 1 cut(s) 21
PpsI GAGTC 1 cut(s) 21
Psp6I CCWGG 1 cut(s) 28
PspGI CCWGG 1 cut(s) 28
PspPI GGNCC 1 cut(s) 112
PstNI CAGNNNCTG 1 cut(s) 29
SaqAI TTAA 2 cut(s) 45, 153
Sau96I GGNCC 1 cut(s) 112
SchI GAGTC 1 cut(s) 22
ScrFI CCNGG 1 cut(s) 30
SetI ASST 4 cut(s) 21, 63, 77, 229
SfaNI GCATC 1 cut(s) 229
SinI GGWCC 1 cut(s) 112
SmlI CTYRAG 1 cut(s) 152
SmoI CTYRAG 1 cut(s) 152
Sse9I AATT 2 cut(s) 81, 116
SspMI CTAG 1 cut(s) 41
StyD4I CCNGG 1 cut(s) 28
TaaI ACNGT 1 cut(s) 106
TaiI ACGT 1 cut(s) 21
TaqI TCGA 1 cut(s) 125
TasI AATT 2 cut(s) 81, 116
TfiI GAWTC 2 cut(s) 37, 86
Tru1I TTAA 2 cut(s) 45, 153
Tru9I TTAA 2 cut(s) 45, 153
TseFI GTSAC 1 cut(s) 14
Tsp45I GTSAC 1 cut(s) 14
TspDTI ATGAA 3 cut(s) 143, 158, 234
Vha464I CTTAAG 1 cut(s) 152
VpaK11BI GGWCC 1 cut(s) 112
XspI CTAG 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.