Rh2AG330200

Histidine kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
47525918 .. 47526379
462 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG330200.1

Sequence Viewer

Length: 387 bp
ATGGTAAGCAAAGCATGCACACCCTTGAGTGGGAAAAAAAATTTGGTTGCCGAGGATGATGACCTTCTGAGCTATTTGGCTATGAGGATTCTATTAAAGGTGGGAGCAACTGTGAAGCTTTGTGAAAATGGAGGAGAAGCTCTAGATGTAATTCGCATAGATCTACTCAACCAAGGGAAACATGAATATGCTAATGGACTGTCAGTAAGTGACTTTGGTGTTGAAATTAACATGCAGATGCCAGAAATGGATGGATTTGAGGCAACAAGGGAGATAAGGAAAGTGGAGAAAACTCACCATGTCCGCATTCTGATCATTGCATTAACAGCTCATACACAGGCGAGGAAACAAGAAGGATGTTGGAGGCTGGCATGGATGACTATTTGA

Protein Analysis

128

Amino Acids

14.32

Weight (kDa)

6.41

Isoelectric Point (pI)

25.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Response_reg PF00072 15 - 115 7.8e-07 Response regulator receiver domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 304
AcsI RAATTY 1 cut(s) 40
AfiI CCNNNNNNNGG 2 cut(s) 29, 30
AgsI TTSAA 1 cut(s) 224
AjuI GAANNNNNNNTTGG 2 cut(s) 26, 58
AluBI AGCT 4 cut(s) 72, 118, 140, 329
AluI AGCT 4 cut(s) 72, 118, 140, 329
ApoI RAATTY 1 cut(s) 40
AsuHPI GGTGA 1 cut(s) 287
BccI CCATC 1 cut(s) 245
BclI TGATCA 1 cut(s) 312
BfaI CTAG 1 cut(s) 143
BglII AGATCT 1 cut(s) 160
BmsI GCATC 1 cut(s) 228
BpuEI CTTGAG 1 cut(s) 46
BsaJI CCNNGG 2 cut(s) 51, 172
BsaXI ACNNNNNCTCC 2 cut(s) 96, 126
Bsc4I CCNNNNNNNGG 2 cut(s) 29, 30
Bse3DI GCAATG 1 cut(s) 315
BseDI CCNNGG 2 cut(s) 51, 172
BseGI GGATG 4 cut(s) 61, 256, 362, 381
BseLI CCNNNNNNNGG 2 cut(s) 29, 30
BseMI GCAATG 1 cut(s) 315
BseMII CTCAG 1 cut(s) 59
BseRI GAGGAG 1 cut(s) 147
BslI CCNNNNNNNGG 2 cut(s) 29, 30
BsmI GAATGC 1 cut(s) 306
Bsp143I GATC 2 cut(s) 160, 312
BspACI CCGC 1 cut(s) 304
BspCNI CTCAG 1 cut(s) 60
BsrDI GCAATG 1 cut(s) 315
BssECI CCNNGG 2 cut(s) 51, 172
BssMI GATC 2 cut(s) 160, 312
BssT1I CCWWGG 1 cut(s) 172
Bst4CI ACNGT 2 cut(s) 112, 201
BstAPI GCANNNNNTGC 1 cut(s) 15
BstC8I GCNNGC 2 cut(s) 16, 369
BstDEI CTNAG 1 cut(s) 68
BstF5I GGATG 4 cut(s) 61, 256, 362, 381
BstKTI GATC 2 cut(s) 163, 315
BstMBI GATC 2 cut(s) 160, 312
BstMWI GCNNNNNNNGC 2 cut(s) 15, 326
BstNSI RCATGY 2 cut(s) 18, 235
BstX2I RGATCY 1 cut(s) 160
BstYI RGATCY 1 cut(s) 160
BtsCI GGATG 4 cut(s) 61, 256, 362, 381
Cac8I GCNNGC 2 cut(s) 16, 369
CviAII CATG 5 cut(s) 15, 182, 232, 299, 372
CviJI RGCY 6 cut(s) 72, 80, 118, 140, 329, 367
CviKI_1 RGCY 6 cut(s) 72, 80, 118, 140, 329, 367
DdeI CTNAG 1 cut(s) 68
DpnI GATC 2 cut(s) 162, 314
DpnII GATC 2 cut(s) 160, 312
Eco130I CCWWGG 1 cut(s) 172
EcoT14I CCWWGG 1 cut(s) 172
ErhI CCWWGG 1 cut(s) 172
FaeI CATG 5 cut(s) 18, 185, 235, 302, 375
FaiI YATR 9 cut(s) 16, 83, 158, 183, 189, 233, 300, 333, 373
FatI CATG 5 cut(s) 14, 181, 231, 298, 371
FbaI TGATCA 1 cut(s) 312
FokI GGATG 3 cut(s) 68, 263, 369
FspBI CTAG 1 cut(s) 143
Hin1II CATG 5 cut(s) 18, 185, 235, 302, 375
HindIII AAGCTT 1 cut(s) 116
HinfI GANTC 1 cut(s) 88
HphI GGTGA 1 cut(s) 287
Hpy188I TCNGA 2 cut(s) 69, 312
Hpy188III TCNNGA 1 cut(s) 143
HpyAV CCTTC 2 cut(s) 74, 347
HpyCH4III ACNGT 2 cut(s) 112, 201
HpyCH4V TGCA 3 cut(s) 18, 235, 320
HpyF10VI GCNNNNNNNGC 2 cut(s) 15, 326
HpyF3I CTNAG 1 cut(s) 68
Hsp92II CATG 5 cut(s) 18, 185, 235, 302, 375
Ksp22I TGATCA 1 cut(s) 312
Kzo9I GATC 2 cut(s) 160, 312
LmnI GCTCC 1 cut(s) 104
LpnPI CCDG 3 cut(s) 255, 323, 353
LweI GCATC 1 cut(s) 228
MaeI CTAG 1 cut(s) 143
MaeIII GTNAC 1 cut(s) 209
MalI GATC 2 cut(s) 162, 314
MboI GATC 2 cut(s) 160, 312
MflI RGATCY 1 cut(s) 160
MluCI AATT 3 cut(s) 40, 150, 225
MmeI TCCRAC 1 cut(s) 341
MnlI CCTC 6 cut(s) 46, 78, 125, 253, 336, 357
MseI TTAA 3 cut(s) 95, 228, 323
MslI CAYNNNNRTG 2 cut(s) 186, 236
Mva1269I GAATGC 1 cut(s) 306
MwoI GCNNNNNNNGC 2 cut(s) 15, 326
NdeII GATC 2 cut(s) 160, 312
NlaIII CATG 5 cut(s) 18, 185, 235, 302, 375
NmeAIII GCCGAG 1 cut(s) 76
NmuCI GTSAC 1 cut(s) 209
NspI RCATGY 2 cut(s) 18, 235
PaeI GCATGC 1 cut(s) 18
PctI GAATGC 1 cut(s) 306
PfeI GAWTC 1 cut(s) 88
PsuI RGATCY 1 cut(s) 160
RseI CAYNNNNRTG 2 cut(s) 186, 236
SaqAI TTAA 3 cut(s) 95, 228, 323
Sau3AI GATC 2 cut(s) 160, 312
SetI ASST 6 cut(s) 66, 74, 102, 120, 142, 331
SfaNI GCATC 1 cut(s) 228
SmiMI CAYNNNNRTG 2 cut(s) 186, 236
SmlI CTYRAG 1 cut(s) 25
SmoI CTYRAG 1 cut(s) 25
SphI GCATGC 1 cut(s) 18
Sse9I AATT 3 cut(s) 40, 150, 225
SsiI CCGC 1 cut(s) 304
SspMI CTAG 1 cut(s) 143
StyI CCWWGG 1 cut(s) 172
TaaI ACNGT 2 cut(s) 112, 201
TasI AATT 3 cut(s) 40, 150, 225
TfiI GAWTC 1 cut(s) 88
Tru1I TTAA 3 cut(s) 95, 228, 323
Tru9I TTAA 3 cut(s) 95, 228, 323
TseFI GTSAC 1 cut(s) 209
Tsp45I GTSAC 1 cut(s) 209
TspDTI ATGAA 1 cut(s) 198
XapI RAATTY 1 cut(s) 40
XbaI TCTAGA 1 cut(s) 142
XceI RCATGY 2 cut(s) 18, 235
XspI CTAG 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.