Rh3AG316400

Histidine kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Forward (+)
43227014 .. 43227622
609 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG316400.1

Sequence Viewer

Length: 534 bp
ATGACCAGTCTGATAATGTTGGTTCTACGCCAAGAAATTCACCAGTTGGTCATGACCATACACTTCTTCATAGAGAAATACATGAACATGGTAAGCCAAGCATGCACACCCTTGAGTGGGAAAAAAAATTTGGTTGCTGAGGATGATGACCTTCTGAGCTATTTGGCTATGAGGATTCTGTTAAAGGTGGGACCAACTGTGAAGCTTTGTGAAAATGGAGGAGAAGCTCCAGATGTAATTCGCATAGATATACTCAACCAAGGGAAACATGAATATACTAATGGACTGTCAGTGAGTGACTTTGGTGTTGAAATTAACATGCAGATGCCAGAAATGGATGGATTTGAGGCAACAAGGGAGATAAGGAAAGTGGAGAAAACTCACCATATCCGCATTCTGATCATTGCATTAACAGCTCATACACCAGGCGAGGAAACAAGAAAGATGTTGGAGGCTGGCATGGATGACTATTTGAGCAAACCCTTGGAAAAGGGTCGTCTACTTGAAACAATGGGTAGACTGGTGGGGAAGTAG

Protein Analysis

177

Amino Acids

20.01

Weight (kDa)

5.88

Isoelectric Point (pI)

30.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Response_reg PF00072 45 - 170 1.6e-13 Response regulator receiver domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 499, 517
AciI CCGC 1 cut(s) 391
AcsI RAATTY 2 cut(s) 36, 127
AfiI CCNNNNNNNGG 2 cut(s) 116, 117
AgsI TTSAA 2 cut(s) 311, 506
AjnI CCWGG 1 cut(s) 424
AjuI GAANNNNNNNTTGG 2 cut(s) 113, 145
AluBI AGCT 4 cut(s) 159, 205, 227, 416
AluI AGCT 4 cut(s) 159, 205, 227, 416
ApoI RAATTY 2 cut(s) 36, 127
AspS9I GGNCC 1 cut(s) 191
AsuHPI GGTGA 2 cut(s) 32, 374
AvaII GGWCC 1 cut(s) 191
BbvCI CCTCAGC 1 cut(s) 138
BccI CCATC 1 cut(s) 332
BciT130I CCWGG 1 cut(s) 426
BclI TGATCA 1 cut(s) 399
Bme1390I CCNGG 1 cut(s) 426
Bme18I GGWCC 1 cut(s) 191
BmgT120I GGNCC 1 cut(s) 191
BmiI GGNNCC 1 cut(s) 192
BmrFI CCNGG 1 cut(s) 426
BmsI GCATC 1 cut(s) 315
BpmI CTGGAG 1 cut(s) 213
Bpu10I CCTNAGC 1 cut(s) 138
BpuEI CTTGAG 1 cut(s) 133
BsaJI CCNNGG 2 cut(s) 259, 483
Bsc4I CCNNNNNNNGG 2 cut(s) 116, 117
Bse1I ACTGG 3 cut(s) 6, 43, 525
Bse3DI GCAATG 1 cut(s) 402
BseBI CCWGG 1 cut(s) 426
BseDI CCNNGG 2 cut(s) 259, 483
BseGI GGATG 3 cut(s) 148, 343, 469
BseLI CCNNNNNNNGG 2 cut(s) 116, 117
BseMI GCAATG 1 cut(s) 402
BseMII CTCAG 2 cut(s) 129, 146
BseNI ACTGG 3 cut(s) 6, 43, 525
BseRI GAGGAG 1 cut(s) 234
BslFI GGGAC 1 cut(s) 204
BslI CCNNNNNNNGG 2 cut(s) 116, 117
BsmFI GGGAC 1 cut(s) 204
BsmI GAATGC 1 cut(s) 393
Bsp143I GATC 1 cut(s) 399
BspACI CCGC 1 cut(s) 391
BspCNI CTCAG 2 cut(s) 130, 147
BspHI TCATGA 1 cut(s) 51
BspLI GGNNCC 1 cut(s) 192
BsrDI GCAATG 1 cut(s) 402
BsrI ACTGG 3 cut(s) 6, 43, 525
BssECI CCNNGG 2 cut(s) 259, 483
BssMI GATC 1 cut(s) 399
BssT1I CCWWGG 2 cut(s) 259, 483
Bst2UI CCWGG 1 cut(s) 426
Bst4CI ACNGT 2 cut(s) 199, 288
BstC8I GCNNGC 2 cut(s) 103, 457
BstDEI CTNAG 2 cut(s) 138, 155
BstF5I GGATG 3 cut(s) 148, 343, 469
BstKTI GATC 1 cut(s) 402
BstMBI GATC 1 cut(s) 399
BstMWI GCNNNNNNNGC 2 cut(s) 102, 413
BstNI CCWGG 1 cut(s) 426
BstNSI RCATGY 2 cut(s) 105, 322
BstSCI CCNGG 1 cut(s) 424
BtsCI GGATG 3 cut(s) 148, 343, 469
BtsIMutI CAGTG 1 cut(s) 297
Cac8I GCNNGC 2 cut(s) 103, 457
CciI TCATGA 1 cut(s) 51
Cfr13I GGNCC 1 cut(s) 191
CviAII CATG 7 cut(s) 52, 82, 88, 102, 269, 319, 460
CviJI RGCY 7 cut(s) 96, 159, 167, 205, 227, 416, 455
CviKI_1 RGCY 7 cut(s) 96, 159, 167, 205, 227, 416, 455
DdeI CTNAG 2 cut(s) 138, 155
DpnI GATC 1 cut(s) 401
DpnII GATC 1 cut(s) 399
Eco130I CCWWGG 2 cut(s) 259, 483
Eco47I GGWCC 1 cut(s) 191
EcoRII CCWGG 1 cut(s) 424
EcoT14I CCWWGG 2 cut(s) 259, 483
ErhI CCWWGG 2 cut(s) 259, 483
FaeI CATG 7 cut(s) 55, 85, 91, 105, 272, 322, 463
FaqI GGGAC 1 cut(s) 204
FatI CATG 7 cut(s) 51, 81, 87, 101, 268, 318, 459
FbaI TGATCA 1 cut(s) 399
FblI GTMKAC 2 cut(s) 499, 517
FokI GGATG 3 cut(s) 155, 350, 476
GsuI CTGGAG 1 cut(s) 213
Hin1II CATG 7 cut(s) 55, 85, 91, 105, 272, 322, 463
HindIII AAGCTT 1 cut(s) 203
HinfI GANTC 1 cut(s) 175
HphI GGTGA 2 cut(s) 32, 374
Hpy166II GTNNAC 2 cut(s) 500, 518
Hpy188I TCNGA 3 cut(s) 12, 156, 399
Hpy188III TCNNGA 2 cut(s) 52, 230
Hpy8I GTNNAC 2 cut(s) 500, 518
HpyAV CCTTC 1 cut(s) 161
HpyCH4III ACNGT 2 cut(s) 199, 288
HpyCH4V TGCA 3 cut(s) 105, 322, 407
HpyF10VI GCNNNNNNNGC 2 cut(s) 102, 413
HpyF3I CTNAG 2 cut(s) 138, 155
Hsp92II CATG 7 cut(s) 55, 85, 91, 105, 272, 322, 463
Ksp22I TGATCA 1 cut(s) 399
Kzo9I GATC 1 cut(s) 399
LmnI GCTCC 1 cut(s) 232
LpnPI CCDG 8 cut(s) 19, 56, 243, 342, 411, 438, 441, 506
LweI GCATC 1 cut(s) 315
MaeIII GTNAC 1 cut(s) 296
MalI GATC 1 cut(s) 401
MboI GATC 1 cut(s) 399
MboII GAAGA 1 cut(s) 58
MluCI AATT 4 cut(s) 36, 127, 237, 312
MmeI TCCRAC 1 cut(s) 429
MnlI CCTC 6 cut(s) 133, 165, 212, 340, 424, 445
MseI TTAA 3 cut(s) 182, 315, 410
MslI CAYNNNNRTG 2 cut(s) 86, 323
MspR9I CCNGG 1 cut(s) 426
Mva1269I GAATGC 1 cut(s) 393
MvaI CCWGG 1 cut(s) 426
MwoI GCNNNNNNNGC 2 cut(s) 102, 413
NdeII GATC 1 cut(s) 399
NlaIII CATG 7 cut(s) 55, 85, 91, 105, 272, 322, 463
NlaIV GGNNCC 1 cut(s) 192
NmuCI GTSAC 1 cut(s) 296
NspI RCATGY 2 cut(s) 105, 322
PaeI GCATGC 1 cut(s) 105
PagI TCATGA 1 cut(s) 51
PctI GAATGC 1 cut(s) 393
PfeI GAWTC 1 cut(s) 175
Psp6I CCWGG 1 cut(s) 424
PspGI CCWGG 1 cut(s) 424
PspN4I GGNNCC 1 cut(s) 192
PspPI GGNCC 1 cut(s) 191
RseI CAYNNNNRTG 2 cut(s) 86, 323
SaqAI TTAA 3 cut(s) 182, 315, 410
Sau3AI GATC 1 cut(s) 399
Sau96I GGNCC 1 cut(s) 191
ScrFI CCNGG 1 cut(s) 426
SetI ASST 6 cut(s) 153, 161, 189, 207, 229, 418
SfaNI GCATC 1 cut(s) 315
SinI GGWCC 1 cut(s) 191
SmiMI CAYNNNNRTG 2 cut(s) 86, 323
SmlI CTYRAG 1 cut(s) 112
SmoI CTYRAG 1 cut(s) 112
SphI GCATGC 1 cut(s) 105
Sse9I AATT 4 cut(s) 36, 127, 237, 312
SsiI CCGC 1 cut(s) 391
StyD4I CCNGG 1 cut(s) 424
StyI CCWWGG 2 cut(s) 259, 483
TaaI ACNGT 2 cut(s) 199, 288
TasI AATT 4 cut(s) 36, 127, 237, 312
TfiI GAWTC 1 cut(s) 175
Tru1I TTAA 3 cut(s) 182, 315, 410
Tru9I TTAA 3 cut(s) 182, 315, 410
TscAI CASTG 1 cut(s) 297
TseFI GTSAC 1 cut(s) 296
Tsp45I GTSAC 1 cut(s) 296
TspDTI ATGAA 3 cut(s) 58, 98, 285
TspRI CASTG 1 cut(s) 297
VpaK11BI GGWCC 1 cut(s) 191
XapI RAATTY 2 cut(s) 36, 127
XceI RCATGY 2 cut(s) 105, 322
XmiI GTMKAC 2 cut(s) 499, 517
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.