Rmu_co8191434.1_g000001

Histidine kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8191434.1
Physical Location & Seq
Forward (+)
234 .. 443
210 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8191434.1_g000001.1.cds

Sequence Viewer

Length: 210 bp
atgccagaaatggatggatttgaggcaacaagggagataaggaaagtggagaaaactcaccatgtccgcattcctatcattgcattaacagctcatacaccaggcgaggaaacaagaaggatgttggaggctggcatggatgactatttgagcaaacccttggaaaagggtcgtctacttgaaacaatgggtagactggtggggaagtag

Protein Analysis

69

Amino Acids

7.89

Weight (kDa)

6.83

Isoelectric Point (pI)

24.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 175, 193
AciI CCGC 1 cut(s) 67
AgsI TTSAA 1 cut(s) 182
AjnI CCWGG 1 cut(s) 100
AluBI AGCT 1 cut(s) 92
AluI AGCT 1 cut(s) 92
AsuHPI GGTGA 1 cut(s) 50
BccI CCATC 1 cut(s) 8
BciT130I CCWGG 1 cut(s) 102
Bme1390I CCNGG 1 cut(s) 102
BmrFI CCNGG 1 cut(s) 102
BsaJI CCNNGG 1 cut(s) 159
Bse1I ACTGG 1 cut(s) 201
Bse3DI GCAATG 1 cut(s) 78
BseBI CCWGG 1 cut(s) 102
BseDI CCNNGG 1 cut(s) 159
BseGI GGATG 3 cut(s) 19, 126, 145
BseMI GCAATG 1 cut(s) 78
BseNI ACTGG 1 cut(s) 201
BsmI GAATGC 1 cut(s) 69
BspACI CCGC 1 cut(s) 67
BsrDI GCAATG 1 cut(s) 78
BsrI ACTGG 1 cut(s) 201
BssECI CCNNGG 1 cut(s) 159
BssT1I CCWWGG 1 cut(s) 159
Bst2UI CCWGG 1 cut(s) 102
BstC8I GCNNGC 1 cut(s) 133
BstF5I GGATG 3 cut(s) 19, 126, 145
BstMWI GCNNNNNNNGC 1 cut(s) 89
BstNI CCWGG 1 cut(s) 102
BstSCI CCNGG 1 cut(s) 100
BtsCI GGATG 3 cut(s) 19, 126, 145
Cac8I GCNNGC 1 cut(s) 133
CviAII CATG 2 cut(s) 62, 136
CviJI RGCY 2 cut(s) 92, 131
CviKI_1 RGCY 2 cut(s) 92, 131
Eco130I CCWWGG 1 cut(s) 159
EcoRII CCWGG 1 cut(s) 100
EcoT14I CCWWGG 1 cut(s) 159
ErhI CCWWGG 1 cut(s) 159
FaeI CATG 2 cut(s) 65, 139
FaiI YATR 3 cut(s) 63, 96, 137
FatI CATG 2 cut(s) 61, 135
FblI GTMKAC 2 cut(s) 175, 193
FokI GGATG 3 cut(s) 26, 133, 152
Hin1II CATG 2 cut(s) 65, 139
HphI GGTGA 1 cut(s) 50
Hpy166II GTNNAC 2 cut(s) 176, 194
Hpy8I GTNNAC 2 cut(s) 176, 194
HpyAV CCTTC 1 cut(s) 111
HpyCH4V TGCA 1 cut(s) 83
HpyF10VI GCNNNNNNNGC 1 cut(s) 89
Hsp92II CATG 2 cut(s) 65, 139
LpnPI CCDG 5 cut(s) 18, 87, 114, 117, 182
MmeI TCCRAC 1 cut(s) 105
MnlI CCTC 3 cut(s) 16, 100, 121
MseI TTAA 1 cut(s) 86
MspR9I CCNGG 1 cut(s) 102
Mva1269I GAATGC 1 cut(s) 69
MvaI CCWGG 1 cut(s) 102
MwoI GCNNNNNNNGC 1 cut(s) 89
NlaIII CATG 2 cut(s) 65, 139
PctI GAATGC 1 cut(s) 69
Psp6I CCWGG 1 cut(s) 100
PspGI CCWGG 1 cut(s) 100
SaqAI TTAA 1 cut(s) 86
ScrFI CCNGG 1 cut(s) 102
SetI ASST 1 cut(s) 94
SsiI CCGC 1 cut(s) 67
StyD4I CCNGG 1 cut(s) 100
StyI CCWWGG 1 cut(s) 159
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
XmiI GTMKAC 2 cut(s) 175, 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.