Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8320535.1

Orthogroup ID

OG0003749

Physical Location & Seq

Genomic Coordinates Forward (+)

174 .. 401

Gene Structure 228 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8320535.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 228 bp

atgccagaaatggatgggttcgaagcgaccagggaaatcaggaaagaggagaaatcttacaatgttcgcattccgatcatcgcattaacagctcatgcaaaaggaggcgaggaaacaagaaggatgatggaggctggtatggacgaacatttagagaaaacctccatagtgactagtctaggggaaacactagcaaagattgatcatagtacgaaagcaactagctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004673 GO:0005488 GO:0005515 GO:0005575 GO:0005623 GO:0005886 GO:0005911 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0007154 GO:0007165 GO:0007275 GO:0008150 GO:0008152 GO:0009506 GO:0009553 GO:0009719 GO:0009725 GO:0009735 GO:0009736 GO:0009755 GO:0009888 GO:0009987 GO:0010033 GO:0010087 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0016775 GO:0018106 GO:0018193 GO:0018202 GO:0019538 GO:0023052 GO:0030054 GO:0032501 GO:0032502 GO:0032870 GO:0036211 GO:0040007 GO:0042221 GO:0042802 GO:0042803 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044464 GO:0046983 GO:0048229 GO:0048856 GO:0050789 GO:0050794 GO:0050896 GO:0051716 GO:0055044 GO:0065007 GO:0070887 GO:0071310 GO:0071368 GO:0071495 GO:0071704 GO:0071944 GO:0080117 GO:0080190 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

HATPase_c HisKA Response_reg

Protein Analysis

75

Amino Acids

8.38

Weight (kDa)

5.57

Isoelectric Point (pI)

29.14

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003749)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G47820 AT1G47820
fragaria_vesca	FvH4_3g25600
rosa_chinensis	RchiOBHm_Chr6g0250611 RchiOBHm_Chr6g0250631 RchiOBHm_Chr6g0250921
rosa_laevigata	RLG00000015515
rosa_multiflora	Rmu_co8191434.1_g000001 Rmu_co8320535.1_g000001 Rmu_sc0003835.1_g000011 Rmu_sc0003953.1_g000001 Rmu_sc0028124.1_g000001
rosa_roxburghii	Rroxscaffold_3G00236710
rosa_rugosa	Rorug01G0235800 Rorug01G0235900 Rorug02G0221600
rosa_samantha	Rh2AG097000 Rh2AG330200 Rh3AG071000 Rh3AG316400 Rh3BG073300 Rh3CG071900 Rh6AG006400 Rh6AG006500 Rh6AG007400 Rh6AG007500 Rh6BG003600 Rh6BG004000 Rh6CG004600 Rh6CG004800 Rh6CG005100 Rh6DG004600 Rh6DG005400 Rh7CG471800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	1 cut(s)	211
AhlI	ACTAGT	1 cut(s)	173
AjnI	CCWGG	1 cut(s)	29
AluBI	AGCT	2 cut(s)	92, 225
AluI	AGCT	2 cut(s)	92, 225
AsuII	TTCGAA	1 cut(s)	21
BccI	CCATC	2 cut(s)	8, 121
BciT130I	CCWGG	1 cut(s)	31
BclI	TGATCA	1 cut(s)	202
BcuI	ACTAGT	1 cut(s)	173
BfaI	CTAG	5 cut(s)	174, 179, 191, 222, 226
Bme1390I	CCNGG	1 cut(s)	31
BmrFI	CCNGG	1 cut(s)	31
BplI	GAGNNNNNCTC	2 cut(s)	146, 178
Bpu14I	TTCGAA	1 cut(s)	21
BsaJI	CCNNGG	1 cut(s)	30
BseBI	CCWGG	1 cut(s)	31
BseDI	CCNNGG	1 cut(s)	30
BseGI	GGATG	2 cut(s)	19, 129
BseRI	GAGGAG	1 cut(s)	62
BsmI	GAATGC	1 cut(s)	69
Bsp119I	TTCGAA	1 cut(s)	21
Bsp143I	GATC	2 cut(s)	75, 202
BspT104I	TTCGAA	1 cut(s)	21
BssECI	CCNNGG	1 cut(s)	30
BssMI	GATC	2 cut(s)	75, 202
Bst2UI	CCWGG	1 cut(s)	31
BstBI	TTCGAA	1 cut(s)	21
BstF5I	GGATG	2 cut(s)	19, 129
BstKTI	GATC	2 cut(s)	78, 205
BstMBI	GATC	2 cut(s)	75, 202
BstMWI	GCNNNNNNNGC	1 cut(s)	89
BstNI	CCWGG	1 cut(s)	31
BstSCI	CCNGG	1 cut(s)	29
BtgZI	GCGATG	1 cut(s)	64
BtsCI	GGATG	2 cut(s)	19, 129
Csp6I	GTAC	1 cut(s)	210
CviAII	CATG	1 cut(s)	95
CviJI	RGCY	3 cut(s)	92, 134, 225
CviKI_1	RGCY	3 cut(s)	92, 134, 225
CviQI	GTAC	1 cut(s)	210
DpnI	GATC	2 cut(s)	77, 204
DpnII	GATC	2 cut(s)	75, 202
EcoRII	CCWGG	1 cut(s)	29
FaeI	CATG	1 cut(s)	98
FaiI	YATR	4 cut(s)	96, 140, 167, 207
FatI	CATG	1 cut(s)	94
FbaI	TGATCA	1 cut(s)	202
FokI	GGATG	2 cut(s)	26, 136
FspBI	CTAG	5 cut(s)	174, 179, 191, 222, 226
Hin1II	CATG	1 cut(s)	98
Hpy188I	TCNGA	1 cut(s)	75
Hpy188III	TCNNGA	1 cut(s)	40
HpyAV	CCTTC	1 cut(s)	114
HpyCH4V	TGCA	1 cut(s)	98
HpyF10VI	GCNNNNNNNGC	1 cut(s)	89
Hsp92II	CATG	1 cut(s)	98
Ksp22I	TGATCA	1 cut(s)	202
Kzo9I	GATC	2 cut(s)	75, 202
LpnPI	CCDG	5 cut(s)	16, 18, 25, 43, 120
MaeI	CTAG	5 cut(s)	174, 179, 191, 222, 226
MaeIII	GTNAC	1 cut(s)	169
MalI	GATC	2 cut(s)	77, 204
MboI	GATC	2 cut(s)	75, 202
MnlI	CCTC	5 cut(s)	40, 98, 103, 124, 172
MseI	TTAA	1 cut(s)	86
MspR9I	CCNGG	1 cut(s)	31
Mva1269I	GAATGC	1 cut(s)	69
MvaI	CCWGG	1 cut(s)	31
MwoI	GCNNNNNNNGC	1 cut(s)	89
NdeII	GATC	2 cut(s)	75, 202
NlaIII	CATG	1 cut(s)	98
NmuCI	GTSAC	1 cut(s)	169
NspV	TTCGAA	1 cut(s)	21
PctI	GAATGC	1 cut(s)	69
Psp6I	CCWGG	1 cut(s)	29
PspGI	CCWGG	1 cut(s)	29
RsaI	GTAC	1 cut(s)	211
RsaNI	GTAC	1 cut(s)	210
SaqAI	TTAA	1 cut(s)	86
Sau3AI	GATC	2 cut(s)	75, 202
ScrFI	CCNGG	1 cut(s)	31
SetI	ASST	3 cut(s)	94, 164, 227
SfuI	TTCGAA	1 cut(s)	21
SpeI	ACTAGT	1 cut(s)	173
SspMI	CTAG	5 cut(s)	174, 179, 191, 222, 226
StyD4I	CCNGG	1 cut(s)	29
TaqI	TCGA	1 cut(s)	21
Tru1I	TTAA	1 cut(s)	86
Tru9I	TTAA	1 cut(s)	86
TseFI	GTSAC	1 cut(s)	169
Tsp45I	GTSAC	1 cut(s)	169
XspI	CTAG	5 cut(s)	174, 179, 191, 222, 226

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.