FvH4_3g25600

Histidine kinase

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Reverse (-)
18506089 .. 18506411
323 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g25600.t1

Sequence Viewer

Length: 240 bp
ATGGACTGCCAGATGCCAAAAATGGATGGTTGCGAAGCGACCAGGGAAATAAGAAAAGAGGAGAAATTGTACAATGTTCGCATTCCGATCATTGCATTAACAGCTCATGAAAAAGGAGGCGAGGAAACAAGAAGGATGATGGAGGCTGATATGGATGAAAATTTAGAGAAAACTGCCATAACGACTAGTCTAGTGGAAACACTTGGAAAGATTGATCATAGTACTAAAGCGAATAGATGA

Protein Analysis

80

Amino Acids

9.02

Weight (kDa)

5.37

Isoelectric Point (pI)

29.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Response_reg PF00072 1 - 67 2.6e-10 Response regulator receiver domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 160
AfaI GTAC 2 cut(s) 71, 223
AhlI ACTAGT 1 cut(s) 185
AjnI CCWGG 1 cut(s) 41
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
ApoI RAATTY 1 cut(s) 160
BccI CCATC 2 cut(s) 20, 133
BciT130I CCWGG 1 cut(s) 43
BclI TGATCA 1 cut(s) 214
BcuI ACTAGT 1 cut(s) 185
BfaI CTAG 2 cut(s) 186, 191
BmcAI AGTACT 1 cut(s) 223
Bme1390I CCNGG 1 cut(s) 43
BmrFI CCNGG 1 cut(s) 43
BmsI GCATC 1 cut(s) 3
BsaJI CCNNGG 1 cut(s) 42
BsaXI ACNNNNNCTCC 2 cut(s) 53, 83
Bse3DI GCAATG 1 cut(s) 90
BseBI CCWGG 1 cut(s) 43
BseDI CCNNGG 1 cut(s) 42
BseGI GGATG 3 cut(s) 31, 141, 160
BseMI GCAATG 1 cut(s) 90
BseRI GAGGAG 1 cut(s) 74
BsmI GAATGC 1 cut(s) 81
Bsp1407I TGTACA 1 cut(s) 69
Bsp143I GATC 2 cut(s) 87, 214
BspHI TCATGA 1 cut(s) 106
BsrDI GCAATG 1 cut(s) 90
BsrGI TGTACA 1 cut(s) 69
BssECI CCNNGG 1 cut(s) 42
BssMI GATC 2 cut(s) 87, 214
Bst2UI CCWGG 1 cut(s) 43
BstAUI TGTACA 1 cut(s) 69
BstF5I GGATG 3 cut(s) 31, 141, 160
BstKTI GATC 2 cut(s) 90, 217
BstMBI GATC 2 cut(s) 87, 214
BstMWI GCNNNNNNNGC 1 cut(s) 101
BstNI CCWGG 1 cut(s) 43
BstSCI CCNGG 1 cut(s) 41
BtsCI GGATG 3 cut(s) 31, 141, 160
CciI TCATGA 1 cut(s) 106
Csp6I GTAC 2 cut(s) 70, 222
CviAII CATG 1 cut(s) 107
CviJI RGCY 2 cut(s) 104, 146
CviKI_1 RGCY 2 cut(s) 104, 146
CviQI GTAC 2 cut(s) 70, 222
DpnI GATC 2 cut(s) 89, 216
DpnII GATC 2 cut(s) 87, 214
EcoRII CCWGG 1 cut(s) 41
FaeI CATG 1 cut(s) 110
FaiI YATR 4 cut(s) 108, 152, 179, 219
FatI CATG 1 cut(s) 106
FbaI TGATCA 1 cut(s) 214
FokI GGATG 3 cut(s) 38, 148, 167
FspBI CTAG 2 cut(s) 186, 191
Hin1II CATG 1 cut(s) 110
Hpy188I TCNGA 1 cut(s) 87
Hpy188III TCNNGA 1 cut(s) 107
HpyAV CCTTC 1 cut(s) 126
HpyCH4V TGCA 1 cut(s) 95
HpyF10VI GCNNNNNNNGC 1 cut(s) 101
Hsp92II CATG 1 cut(s) 110
Ksp22I TGATCA 1 cut(s) 214
Kzo9I GATC 2 cut(s) 87, 214
LpnPI CCDG 3 cut(s) 23, 28, 55
LweI GCATC 1 cut(s) 3
MaeI CTAG 2 cut(s) 186, 191
MalI GATC 2 cut(s) 89, 216
MboI GATC 2 cut(s) 87, 214
MluCI AATT 2 cut(s) 65, 160
MnlI CCTC 4 cut(s) 52, 110, 115, 136
MseI TTAA 1 cut(s) 98
MspR9I CCNGG 1 cut(s) 43
Mva1269I GAATGC 1 cut(s) 81
MvaI CCWGG 1 cut(s) 43
MwoI GCNNNNNNNGC 1 cut(s) 101
NdeII GATC 2 cut(s) 87, 214
NlaIII CATG 1 cut(s) 110
PagI TCATGA 1 cut(s) 106
PctI GAATGC 1 cut(s) 81
Psp6I CCWGG 1 cut(s) 41
PspGI CCWGG 1 cut(s) 41
RsaI GTAC 2 cut(s) 71, 223
RsaNI GTAC 2 cut(s) 70, 222
SaqAI TTAA 1 cut(s) 98
Sau3AI GATC 2 cut(s) 87, 214
ScaI AGTACT 1 cut(s) 223
ScrFI CCNGG 1 cut(s) 43
SetI ASST 1 cut(s) 106
SfaNI GCATC 1 cut(s) 3
SgeI CNNG 9 cut(s) 22, 54, 55, 119, 133, 141, 198, 203, 215
SpeI ACTAGT 1 cut(s) 185
Sse9I AATT 2 cut(s) 65, 160
SspMI CTAG 2 cut(s) 186, 191
StyD4I CCNGG 1 cut(s) 41
TasI AATT 2 cut(s) 65, 160
TatI WGTACW 2 cut(s) 69, 221
Tru1I TTAA 1 cut(s) 98
Tru9I TTAA 1 cut(s) 98
TspDTI ATGAA 2 cut(s) 123, 171
XapI RAATTY 1 cut(s) 160
XspI CTAG 2 cut(s) 186, 191
ZrmI AGTACT 1 cut(s) 223
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.