AT2G24410

production of miRNAs involved in gene silencing by miRNA

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
Physical Location & Seq
Reverse (-)
10379159 .. 10379407
249 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G24410.1

Sequence Viewer

Length: 237 bp
ATGATTGAAAAACATGGTGTGCGATGTTTTGAGCTATCGAGGAAACTTGCTGAAGAAACCAACATATACAAAGGTATCACACTCCTCTTCAATAATCCCGTAGATAATAGAAAACCCAAAGAAAGATGGAGACTTTATCATTTTAAGGATGGTGAACCACTGAAAGAGACACTTTGCATTCATTACCAAATTTGCTACCTCTTTGGACGTGAGAGAAAGATCCGACATTCCTACTAA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

9.57

Weight (kDa)

9.44

Isoelectric Point (pI)

35.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 214
AcsI RAATTY 1 cut(s) 189
AcuI CTGAAG 1 cut(s) 72
AgsI TTSAA 2 cut(s) 8, 91
AjiI CACGTC 1 cut(s) 209
AluBI AGCT 1 cut(s) 34
AluI AGCT 1 cut(s) 34
Alw26I GTCTC 2 cut(s) 124, 161
AlwI GGATC 1 cut(s) 214
ApoI RAATTY 1 cut(s) 189
AsuHPI GGTGA 1 cut(s) 164
BaeI ACNNNNGTAYC 2 cut(s) 58, 91
BccI CCATC 2 cut(s) 120, 143
BcoDI GTCTC 2 cut(s) 124, 161
BmgBI CACGTC 1 cut(s) 209
BseGI GGATG 1 cut(s) 154
BseRI GAGGAG 1 cut(s) 74
BsmAI GTCTC 2 cut(s) 124, 161
BsmI GAATGC 1 cut(s) 177
Bsp143I GATC 1 cut(s) 219
BspPI GGATC 1 cut(s) 214
BssMI GATC 1 cut(s) 219
Bst6I CTCTTC 1 cut(s) 92
BstF5I GGATG 1 cut(s) 154
BstKTI GATC 1 cut(s) 222
BstMAI GTCTC 2 cut(s) 124, 161
BstMBI GATC 1 cut(s) 219
BstX2I RGATCY 1 cut(s) 219
BstYI RGATCY 1 cut(s) 219
BtgZI GCGATG 1 cut(s) 37
BtrI CACGTC 1 cut(s) 209
BtsCI GGATG 1 cut(s) 154
BtsIMutI CAGTG 1 cut(s) 158
CviAII CATG 1 cut(s) 14
CviJI RGCY 1 cut(s) 34
CviKI_1 RGCY 1 cut(s) 34
DpnI GATC 1 cut(s) 221
DpnII GATC 1 cut(s) 219
Eam1104I CTCTTC 1 cut(s) 92
EarI CTCTTC 1 cut(s) 92
Eco57I CTGAAG 1 cut(s) 72
FaeI CATG 1 cut(s) 17
FaiI YATR 3 cut(s) 15, 65, 67
FalI AAGNNNNNCTT 2 cut(s) 156, 188
FatI CATG 1 cut(s) 13
FokI GGATG 1 cut(s) 161
Hin1II CATG 1 cut(s) 17
HphI GGTGA 1 cut(s) 164
Hpy166II GTNNAC 1 cut(s) 155
Hpy188I TCNGA 1 cut(s) 224
Hpy8I GTNNAC 1 cut(s) 155
HpyCH4IV ACGT 1 cut(s) 208
HpyCH4V TGCA 1 cut(s) 177
HpySE526I ACGT 1 cut(s) 208
Hsp92II CATG 1 cut(s) 17
Kzo9I GATC 1 cut(s) 219
MaeII ACGT 1 cut(s) 208
MalI GATC 1 cut(s) 221
MboI GATC 1 cut(s) 219
MboII GAAGA 2 cut(s) 65, 79
MflI RGATCY 1 cut(s) 219
MluCI AATT 1 cut(s) 189
MnlI CCTC 3 cut(s) 33, 95, 209
MseI TTAA 1 cut(s) 144
Mva1269I GAATGC 1 cut(s) 177
NdeII GATC 1 cut(s) 219
NlaIII CATG 1 cut(s) 17
PctI GAATGC 1 cut(s) 177
PsuI RGATCY 1 cut(s) 219
SaqAI TTAA 1 cut(s) 144
Sau3AI GATC 1 cut(s) 219
SetI ASST 4 cut(s) 36, 76, 201, 211
SgeI CNNG 5 cut(s) 26, 51, 59, 110, 221
Sse9I AATT 1 cut(s) 189
TaiI ACGT 1 cut(s) 211
TaqI TCGA 1 cut(s) 38
TasI AATT 1 cut(s) 189
Tru1I TTAA 1 cut(s) 144
Tru9I TTAA 1 cut(s) 144
TscAI CASTG 1 cut(s) 165
TspDTI ATGAA 1 cut(s) 170
TspRI CASTG 1 cut(s) 165
XapI RAATTY 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.