AT3G44760

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Forward (+)
16305322 .. 16306378
1057 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G44760.1

Sequence Viewer

Length: 570 bp
ATGAAGAAATTGGGATTGACTTGCAGATGGATAGCTTCGGATGCAGTTTTCAACAAACTCTCGCTCAAATTCAACGTTCTCGTTGTTGTAACGCTGATGTTGCTGAGGATCTGGGGAGAATCTAACTTCATCGATTTCGTTAACTTTGAGATATCGAAAGTAACTTTCCGTGAGGCGATGGGGCTTTTGACTCTGATGATGGCTTATTTTTACTACTTGGGAAGTTTACGCTGGATTGTATCTGAGTTGCTTGAGCTTAACGATCCATTGGTAAGGATTGAAAAAAGAGTTGGCTATGATATATGGTTTCTTGACTCTGGCCTTTTACCTCGTGAACCTGTTTGGATTCTTCTGGGGAATTTTATGGCTACTAGTTTCTCCTCCGAGTATTCTTTTGGTTATTCGATTCGCCAAGTCCATTACCTTTTGAGAATCTCAAGATTAGATTCCTTGGAGATGAAGATTCAACTTAATTCAGCATATGGATTTTTTGGGGTTCCTCTTTTAGGATTGAATCGTTTGGTGGTGATTTTTTTGGTTTTTAGGTGTTGTAATTACTGCGATGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

189

Amino Acids

22.06

Weight (kDa)

8.33

Isoelectric Point (pI)

37.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 75
AclWI GGATC 2 cut(s) 116, 257
AcsI RAATTY 2 cut(s) 68, 358
AfiI CCNNNNNNNGG 1 cut(s) 506
AgsI TTSAA 5 cut(s) 52, 73, 281, 467, 514
AhlI ACTAGT 1 cut(s) 371
AjuI GAANNNNNNNTTGG 2 cut(s) 273, 305
AluBI AGCT 2 cut(s) 35, 256
AluI AGCT 2 cut(s) 35, 256
AlwI GGATC 2 cut(s) 116, 257
AoxI GGCC 1 cut(s) 319
ApoI RAATTY 2 cut(s) 68, 358
AsuHPI GGTGA 1 cut(s) 538
BauI CACGAG 1 cut(s) 330
BbvCI CCTCAGC 1 cut(s) 104
BccI CCATC 3 cut(s) 21, 172, 193
BcuI ACTAGT 1 cut(s) 371
BfaI CTAG 1 cut(s) 372
BmiI GGNNCC 1 cut(s) 498
BmsI GCATC 1 cut(s) 31
Bpu10I CCTNAGC 1 cut(s) 104
BpuEI CTTGAG 2 cut(s) 272, 421
Bsa29I ATCGAT 1 cut(s) 132
BsaJI CCNNGG 1 cut(s) 450
Bsc4I CCNNNNNNNGG 1 cut(s) 506
BseCI ATCGAT 1 cut(s) 132
BseDI CCNNGG 1 cut(s) 450
BseGI GGATG 1 cut(s) 46
BseLI CCNNNNNNNGG 1 cut(s) 506
BseMII CTCAG 2 cut(s) 95, 234
BseRI GAGGAG 1 cut(s) 370
BshFI GGCC 1 cut(s) 321
BshVI ATCGAT 1 cut(s) 132
BslI CCNNNNNNNGG 1 cut(s) 506
BsnI GGCC 1 cut(s) 321
Bsp143I GATC 2 cut(s) 108, 262
BspANI GGCC 1 cut(s) 321
BspCNI CTCAG 2 cut(s) 96, 235
BspDI ATCGAT 1 cut(s) 132
BspLI GGNNCC 1 cut(s) 498
BspPI GGATC 2 cut(s) 116, 257
BssECI CCNNGG 1 cut(s) 450
BssMI GATC 2 cut(s) 108, 262
BssSI CACGAG 1 cut(s) 330
BssT1I CCWWGG 1 cut(s) 450
Bst2BI CACGAG 1 cut(s) 330
BstDEI CTNAG 2 cut(s) 104, 243
BstENI CCTNNNNNAGG 1 cut(s) 504
BstF5I GGATG 1 cut(s) 46
BstKTI GATC 2 cut(s) 111, 265
BstMBI GATC 2 cut(s) 108, 262
BstMWI GCNNNNNNNGC 2 cut(s) 41, 100
BstX2I RGATCY 1 cut(s) 108
BstYI RGATCY 1 cut(s) 108
Bsu15I ATCGAT 1 cut(s) 132
BsuRI GGCC 1 cut(s) 321
BsuTUI ATCGAT 1 cut(s) 132
BtgZI GCGATG 1 cut(s) 191
BtsCI GGATG 1 cut(s) 46
ClaI ATCGAT 1 cut(s) 132
CviJI RGCY 7 cut(s) 35, 184, 203, 256, 294, 321, 368
CviKI_1 RGCY 7 cut(s) 35, 184, 203, 256, 294, 321, 368
DdeI CTNAG 2 cut(s) 104, 243
DpnI GATC 2 cut(s) 110, 264
DpnII GATC 2 cut(s) 108, 262
Eco130I CCWWGG 1 cut(s) 450
Eco32I GATATC 1 cut(s) 153
EcoNI CCTNNNNNAGG 1 cut(s) 504
EcoRV GATATC 1 cut(s) 153
EcoT14I CCWWGG 1 cut(s) 450
ErhI CCWWGG 1 cut(s) 450
FaiI YATR 6 cut(s) 297, 302, 304, 365, 481, 483
FauNDI CATATG 1 cut(s) 481
FokI GGATG 1 cut(s) 53
FspBI CTAG 1 cut(s) 372
HaeIII GGCC 1 cut(s) 321
HincII GTYRAC 1 cut(s) 142
HindII GTYRAC 1 cut(s) 142
HinfI GANTC 9 cut(s) 119, 190, 314, 346, 406, 432, 446, 463, 514
HpaI GTTAAC 1 cut(s) 142
HphI GGTGA 1 cut(s) 538
Hpy166II GTNNAC 3 cut(s) 142, 227, 335
Hpy188I TCNGA 4 cut(s) 40, 195, 244, 385
Hpy188III TCNNGA 3 cut(s) 311, 332, 438
Hpy8I GTNNAC 3 cut(s) 142, 227, 335
HpyCH4IV ACGT 1 cut(s) 75
HpyCH4V TGCA 2 cut(s) 24, 44
HpyF10VI GCNNNNNNNGC 2 cut(s) 41, 100
HpyF3I CTNAG 2 cut(s) 104, 243
HpySE526I ACGT 1 cut(s) 75
KspAI GTTAAC 1 cut(s) 142
Kzo9I GATC 2 cut(s) 108, 262
LpnPI CCDG 5 cut(s) 97, 217, 303, 338, 351
LweI GCATC 1 cut(s) 31
MaeI CTAG 1 cut(s) 372
MaeII ACGT 1 cut(s) 75
MaeIII GTNAC 2 cut(s) 88, 160
MalI GATC 2 cut(s) 110, 264
MboI GATC 2 cut(s) 108, 262
MboII GAAGA 3 cut(s) 16, 341, 472
MflI RGATCY 1 cut(s) 108
MluCI AATT 5 cut(s) 8, 68, 358, 472, 553
MlyI GAGTC 2 cut(s) 184, 308
MnlI CCTC 5 cut(s) 99, 166, 339, 391, 510
MseI TTAA 3 cut(s) 141, 258, 471
MwoI GCNNNNNNNGC 2 cut(s) 41, 100
NdeI CATATG 1 cut(s) 481
NdeII GATC 2 cut(s) 108, 262
NlaIV GGNNCC 1 cut(s) 498
PfeI GAWTC 7 cut(s) 119, 346, 406, 432, 446, 463, 514
PleI GAGTC 2 cut(s) 184, 308
PpsI GAGTC 2 cut(s) 184, 308
Psp1406I AACGTT 1 cut(s) 75
PspN4I GGNNCC 1 cut(s) 498
PsuI RGATCY 1 cut(s) 108
SaqAI TTAA 3 cut(s) 141, 258, 471
Sau3AI GATC 2 cut(s) 108, 262
SchI GAGTC 2 cut(s) 184, 308
SetI ASST 7 cut(s) 37, 78, 258, 331, 340, 426, 548
SfaNI GCATC 1 cut(s) 31
SmlI CTYRAG 2 cut(s) 251, 436
SmoI CTYRAG 2 cut(s) 251, 436
SpeI ACTAGT 1 cut(s) 371
Sse9I AATT 5 cut(s) 8, 68, 358, 472, 553
SspMI CTAG 1 cut(s) 372
StyI CCWWGG 1 cut(s) 450
TaiI ACGT 1 cut(s) 78
TaqI TCGA 3 cut(s) 132, 155, 404
TasI AATT 5 cut(s) 8, 68, 358, 472, 553
TfiI GAWTC 7 cut(s) 119, 346, 406, 432, 446, 463, 514
Tru1I TTAA 3 cut(s) 141, 258, 471
Tru9I TTAA 3 cut(s) 141, 258, 471
TspDTI ATGAA 3 cut(s) 17, 118, 473
TspGWI ACGGA 1 cut(s) 158
XagI CCTNNNNNAGG 1 cut(s) 504
XapI RAATTY 2 cut(s) 68, 358
XspI CTAG 1 cut(s) 372
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.