FvH4_2g28692

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
Physical Location & Seq
Reverse (-)
22426375 .. 22426791
417 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g28692.t1

Sequence Viewer

Length: 417 bp
ATGAATGATGCAGCAGTTATTCCTTCCTCTACTCCTTTAGAAAAGACACCTACTCCTGCTCCTACAGTTATACCAGATTCTCCACCTACACTAGATTCTCAAAATGATGATGTGTGTGTAGAACAACATGAAGTGGTGTTGCCTGCTGAAGCAACACAAGAAGATGTTGAAGAAGAGATTGAAGAAGAGGTTGTTGAGGTTCAACCTCAAAGGAGGTATCCTACTCGAATTAGGAAACCTCCATCAAAGTGGGACAATTACAAGACCTTTGCTGCAAGGTATCCAATCAAAAAGTTTCTTTCTTATGACAAAGTGTCAAAATCGCATGCTGCCTTTCTCTCAAACATTTCAAGTGAAAGTGAACCAAGAACTTTTCAAGAAGCAAATCTTCAACCAACCTGGAAAAAGGCTATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

139

Amino Acids

15.66

Weight (kDa)

4.88

Isoelectric Point (pI)

68.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 168
AgsI TTSAA 6 cut(s) 170, 182, 203, 351, 377, 392
AhdI GACNNNNNGTC 1 cut(s) 313
AjnI CCWGG 1 cut(s) 398
ApeKI GCWGC 3 cut(s) 11, 272, 329
BbvI GCAGC 3 cut(s) 23, 259, 316
BccI CCATC 1 cut(s) 250
BciT130I CCWGG 1 cut(s) 400
BciVI GTATCC 2 cut(s) 228, 291
BfaI CTAG 1 cut(s) 92
BfmI CTRYAG 1 cut(s) 63
BfuI GTATCC 2 cut(s) 228, 291
BisI GCNGC 3 cut(s) 12, 273, 330
BlsI GCNGC 3 cut(s) 13, 274, 331
Bme1390I CCNGG 1 cut(s) 400
BmeRI GACNNNNNGTC 1 cut(s) 313
BmrFI CCNGG 1 cut(s) 400
BsaXI ACNNNNNCTCC 4 cut(s) 37, 43, 67, 73
BseBI CCWGG 1 cut(s) 400
BseXI GCAGC 3 cut(s) 23, 259, 316
BslFI GGGAC 1 cut(s) 266
BsmFI GGGAC 1 cut(s) 266
Bst2UI CCWGG 1 cut(s) 400
Bst4CI ACNGT 1 cut(s) 67
Bst6I CTCTTC 2 cut(s) 168, 180
BstC8I GCNNGC 2 cut(s) 144, 327
BstNI CCWGG 1 cut(s) 400
BstNSI RCATGY 1 cut(s) 329
BstSCI CCNGG 1 cut(s) 398
BstSFI CTRYAG 1 cut(s) 63
BstV1I GCAGC 3 cut(s) 23, 259, 316
BstXI CCANNNNNNTGG 1 cut(s) 249
BsuI GTATCC 2 cut(s) 228, 291
Cac8I GCNNGC 2 cut(s) 144, 327
CviAII CATG 2 cut(s) 128, 326
CviJI RGCY 1 cut(s) 410
CviKI_1 RGCY 1 cut(s) 410
DriI GACNNNNNGTC 1 cut(s) 313
Eam1104I CTCTTC 2 cut(s) 168, 180
Eam1105I GACNNNNNGTC 1 cut(s) 313
EarI CTCTTC 2 cut(s) 168, 180
Eco57I CTGAAG 1 cut(s) 168
EcoRII CCWGG 1 cut(s) 398
FaeI CATG 2 cut(s) 131, 329
FaiI YATR 5 cut(s) 71, 129, 306, 327, 413
FalI AAGNNNNNCTT 2 cut(s) 372, 404
FaqI GGGAC 1 cut(s) 266
FatI CATG 2 cut(s) 127, 325
Fnu4HI GCNGC 3 cut(s) 12, 273, 330
Fsp4HI GCNGC 3 cut(s) 12, 273, 330
FspBI CTAG 1 cut(s) 92
GluI GCNGC 3 cut(s) 12, 273, 330
Hin1II CATG 2 cut(s) 131, 329
HinfI GANTC 2 cut(s) 77, 95
Hpy166II GTNNAC 1 cut(s) 362
Hpy188III TCNNGA 1 cut(s) 377
Hpy8I GTNNAC 1 cut(s) 362
HpyAV CCTTC 1 cut(s) 33
HpyCH4III ACNGT 1 cut(s) 67
HpyCH4V TGCA 2 cut(s) 11, 275
Hsp92II CATG 2 cut(s) 131, 329
LmnI GCTCC 1 cut(s) 64
LpnPI CCDG 5 cut(s) 69, 87, 156, 385, 412
Lsp1109I GCAGC 3 cut(s) 23, 259, 316
MaeI CTAG 1 cut(s) 92
MboII GAAGA 6 cut(s) 173, 182, 185, 194, 197, 380
MluCI AATT 2 cut(s) 228, 256
MnlI CCTC 6 cut(s) 37, 181, 190, 207, 216, 249
MslI CAYNNNNRTG 1 cut(s) 247
MspR9I CCNGG 1 cut(s) 400
MvaI CCWGG 1 cut(s) 400
NlaIII CATG 2 cut(s) 131, 329
NspI RCATGY 1 cut(s) 329
PaeI GCATGC 1 cut(s) 329
PfeI GAWTC 2 cut(s) 77, 95
PkrI GCNGC 3 cut(s) 13, 274, 331
Psp6I CCWGG 1 cut(s) 398
PspGI CCWGG 1 cut(s) 398
RseI CAYNNNNRTG 1 cut(s) 247
SatI GCNGC 3 cut(s) 12, 273, 330
ScrFI CCNGG 1 cut(s) 400
SfcI CTRYAG 1 cut(s) 63
SmiMI CAYNNNNRTG 1 cut(s) 247
SphI GCATGC 1 cut(s) 329
Sse9I AATT 2 cut(s) 228, 256
SspMI CTAG 1 cut(s) 92
StyD4I CCNGG 1 cut(s) 398
TaaI ACNGT 1 cut(s) 67
TaqI TCGA 1 cut(s) 226
TasI AATT 2 cut(s) 228, 256
TfiI GAWTC 2 cut(s) 77, 95
TseI GCWGC 3 cut(s) 11, 272, 329
TspDTI ATGAA 2 cut(s) 17, 144
XceI RCATGY 1 cut(s) 329
XspI CTAG 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.