Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp05

Orthogroup ID

OG0002557

Physical Location & Seq

Genomic Coordinates Forward (+)

928182 .. 928550

Gene Structure 369 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.5G008900.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 369 bp

GTGACACTAGCAAAACCTCCCAAACATAAACCATGGATCATACTGATCCCTACTTCTTGCAATCCTCGGATCATCCGGGGCTTGTTATTGTCCCAACTTCTTGATGGAGATAATTACAGCACGTGGCGCCGCACGATCATCATTAGTCTTAGTGTGAAAACTAAATTAGGGTTTGTTGATGGCACTATCAAACCTCTCTCTGAAAAAGATTCCAAATACCCCTTGTGGCGTTGCTGCAATGATATGGTGATGGCTTGGTTGTTGAATGTCATCACCCAAGCCCTTGCTAACAGCATCATCTATGTCGACACCCCTACTGAAGTTTGGAGTGATCTGCAGGATAGATTCTCTGTTGGCCATCTCACTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Retrotran_gag_2 Retrotran_gag_3 Retrotrans_gag gag_pre-integrs

Protein Analysis

123

Amino Acids

13.87

Weight (kDa)

9.13

Isoelectric Point (pI)

24.17

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002557)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G48720
fragaria_vesca	FvH4_2g28692 FvH4_5g18842 FvH4_6g09151
malus_domestica	MD02G1224100.v1.1 MD05G1187300.v1.1 MD05G1333300.v1.1 MD11G1249500.v1.1 MD16G1029500.v1.1
prunus_persica	Prupe.5G008900_v2.0.a1 Prupe.6G200700_v2.0.a1 Prupe.7G019700_v2.0.a1
pyrus_communis	pycom01g03530 pycom02g12970 pycom02g19220 pycom05g10750 pycom09g02370 pycom10g16330 pycom14g07330 pycom15g16240
rosa_chinensis	RchiOBHm_Chr1g0340271 RchiOBHm_Chr1g0362001 RchiOBHm_Chr1g0382731 RchiOBHm_Chr2g0152171 RchiOBHm_Chr3g0480511 RchiOBHm_Chr4g0398841 RchiOBHm_Chr5g0081101 RchiOBHm_Chr7g0182361 RchiOBHm_Chr7g0237371
rosa_roxburghii	Rroxscaffold_160G00433850 Rroxscaffold_1G00001000 Rroxscaffold_1G00046300 Rroxscaffold_3G00252380 Rroxscaffold_3G00254550 Rroxscaffold_4G00320010 Rroxscaffold_4G00327310 Rroxscaffold_5G00336230 Rroxscaffold_7G00179260
rosa_samantha	Rh3BG173000
rosa_wichuraiana	Rw4G008490

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	126
AccI	GTMKAC	1 cut(s)	306
AciI	CCGC	1 cut(s)	130
AclWI	GGATC	3 cut(s)	40, 44, 77
AcoI	YGGCCR	1 cut(s)	355
AcuI	CTGAAG	1 cut(s)	339
AcvI	CACGTG	1 cut(s)	123
AcyI	GRCGYC	1 cut(s)	127
AgsI	TTSAA	1 cut(s)	265
AlwI	GGATC	3 cut(s)	40, 44, 77
AoxI	GGCC	1 cut(s)	355
ApeKI	GCWGC	1 cut(s)	234
AspLEI	GCGC	1 cut(s)	129
AsuC2I	CCSGG	1 cut(s)	77
AsuHPI	GGTGA	2 cut(s)	259, 265
BalI	TGGCCA	1 cut(s)	357
BanI	GGYRCC	1 cut(s)	126
BbrPI	CACGTG	1 cut(s)	123
BbvI	GCAGC	1 cut(s)	221
BccI	CCATC	4 cut(s)	98, 173, 244, 366
BcnI	CCSGG	1 cut(s)	77
BfaI	CTAG	1 cut(s)	8
BfmI	CTRYAG	1 cut(s)	335
BfoI	RGCGCY	1 cut(s)	130
BisI	GCNGC	2 cut(s)	130, 235
BlsI	GCNGC	2 cut(s)	131, 236
Bme1390I	CCNGG	1 cut(s)	77
BmiI	GGNNCC	1 cut(s)	128
BmrFI	CCNGG	1 cut(s)	77
BmsI	GCATC	1 cut(s)	303
BpuMI	CCSGG	1 cut(s)	77
BsaAI	YACGTR	1 cut(s)	123
BsaHI	GRCGYC	1 cut(s)	127
BsaJI	CCNNGG	3 cut(s)	32, 65, 76
Bse3DI	GCAATG	1 cut(s)	244
BseDI	CCNNGG	3 cut(s)	32, 65, 76
BseGI	GGATG	1 cut(s)	72
BseMI	GCAATG	1 cut(s)	244
BseXI	GCAGC	1 cut(s)	221
BshFI	GGCC	1 cut(s)	357
BshNI	GGYRCC	1 cut(s)	126
BsiSI	CCGG	1 cut(s)	76
BslFI	GGGAC	1 cut(s)	76
BsmFI	GGGAC	1 cut(s)	76
BsnI	GGCC	1 cut(s)	357
Bsp143I	GATC	5 cut(s)	36, 45, 69, 135, 331
Bsp19I	CCATGG	1 cut(s)	32
BspACI	CCGC	1 cut(s)	130
BspANI	GGCC	1 cut(s)	357
BspLI	GGNNCC	1 cut(s)	128
BspMAI	CTGCAG	1 cut(s)	339
BspPI	GGATC	3 cut(s)	40, 44, 77
BspT107I	GGYRCC	1 cut(s)	126
BsrDI	GCAATG	1 cut(s)	244
BssECI	CCNNGG	3 cut(s)	32, 65, 76
BssMI	GATC	5 cut(s)	36, 45, 69, 135, 331
BssNI	GRCGYC	1 cut(s)	127
BssT1I	CCWWGG	1 cut(s)	32
BstACI	GRCGYC	1 cut(s)	127
BstBAI	YACGTR	1 cut(s)	123
BstDEI	CTNAG	2 cut(s)	149, 366
BstDSI	CCRYGG	1 cut(s)	32
BstF5I	GGATG	1 cut(s)	72
BstH2I	RGCGCY	1 cut(s)	130
BstHHI	GCGC	1 cut(s)	129
BstKTI	GATC	5 cut(s)	39, 48, 72, 138, 334
BstMBI	GATC	5 cut(s)	36, 45, 69, 135, 331
BstMWI	GCNNNNNNNGC	1 cut(s)	126
BstSCI	CCNGG	1 cut(s)	75
BstSFI	CTRYAG	1 cut(s)	335
BstV1I	GCAGC	1 cut(s)	221
BsuRI	GGCC	1 cut(s)	357
BtgI	CCRYGG	1 cut(s)	32
BtsCI	GGATG	1 cut(s)	72
CfoI	GCGC	1 cut(s)	129
CviAII	CATG	1 cut(s)	33
CviJI	RGCY	4 cut(s)	81, 254, 281, 357
CviKI_1	RGCY	4 cut(s)	81, 254, 281, 357
DdeI	CTNAG	2 cut(s)	149, 366
DinI	GGCGCC	1 cut(s)	128
DpnI	GATC	5 cut(s)	38, 47, 71, 137, 333
DpnII	GATC	5 cut(s)	36, 45, 69, 135, 331
EaeI	YGGCCR	1 cut(s)	355
Eco130I	CCWWGG	1 cut(s)	32
Eco57I	CTGAAG	1 cut(s)	339
Eco72I	CACGTG	1 cut(s)	123
EcoT14I	CCWWGG	1 cut(s)	32
EgeI	GGCGCC	1 cut(s)	128
EheI	GGCGCC	1 cut(s)	128
ErhI	CCWWGG	1 cut(s)	32
FaeI	CATG	1 cut(s)	36
FaiI	YATR	5 cut(s)	27, 34, 41, 245, 303
FaqI	GGGAC	1 cut(s)	76
FatI	CATG	1 cut(s)	32
FblI	GTMKAC	1 cut(s)	306
Fnu4HI	GCNGC	2 cut(s)	130, 235
FokI	GGATG	1 cut(s)	59
Fsp4HI	GCNGC	2 cut(s)	130, 235
FspBI	CTAG	1 cut(s)	8
GlaI	GCGC	1 cut(s)	128
GluI	GCNGC	2 cut(s)	130, 235
HaeII	RGCGCY	1 cut(s)	130
HaeIII	GGCC	1 cut(s)	357
HapII	CCGG	1 cut(s)	76
HhaI	GCGC	1 cut(s)	129
Hin1I	GRCGYC	1 cut(s)	127
Hin1II	CATG	1 cut(s)	36
Hin6I	GCGC	1 cut(s)	127
HinP1I	GCGC	1 cut(s)	127
HincII	GTYRAC	1 cut(s)	307
HindII	GTYRAC	1 cut(s)	307
HinfI	GANTC	2 cut(s)	209, 345
HpaII	CCGG	1 cut(s)	76
HphI	GGTGA	2 cut(s)	259, 265
Hpy166II	GTNNAC	1 cut(s)	307
Hpy188I	TCNGA	2 cut(s)	69, 202
Hpy188III	TCNNGA	1 cut(s)	101
Hpy8I	GTNNAC	1 cut(s)	307
HpyCH4IV	ACGT	1 cut(s)	122
HpyCH4V	TGCA	3 cut(s)	60, 237, 337
HpyF10VI	GCNNNNNNNGC	1 cut(s)	126
HpyF3I	CTNAG	2 cut(s)	149, 366
HpySE526I	ACGT	1 cut(s)	122
Hsp92I	GRCGYC	1 cut(s)	127
Hsp92II	CATG	1 cut(s)	36
HspAI	GCGC	1 cut(s)	127
KasI	GGCGCC	1 cut(s)	126
Kzo9I	GATC	5 cut(s)	36, 45, 69, 135, 331
LpnPI	CCDG	2 cut(s)	89, 323
Lsp1109I	GCAGC	1 cut(s)	221
LweI	GCATC	1 cut(s)	303
MaeI	CTAG	1 cut(s)	8
MaeII	ACGT	1 cut(s)	122
MalI	GATC	5 cut(s)	38, 47, 71, 137, 333
MboI	GATC	5 cut(s)	36, 45, 69, 135, 331
MlsI	TGGCCA	1 cut(s)	357
MluCI	AATT	2 cut(s)	112, 164
MluNI	TGGCCA	1 cut(s)	357
Mly113I	GGCGCC	1 cut(s)	127
MnlI	CCTC	3 cut(s)	27, 75, 204
Mox20I	TGGCCA	1 cut(s)	357
MscI	TGGCCA	1 cut(s)	357
Msp20I	TGGCCA	1 cut(s)	357
MspI	CCGG	1 cut(s)	76
MspR9I	CCNGG	1 cut(s)	77
MwoI	GCNNNNNNNGC	1 cut(s)	126
NarI	GGCGCC	1 cut(s)	127
NciI	CCSGG	1 cut(s)	77
NcoI	CCATGG	1 cut(s)	32
NdeII	GATC	5 cut(s)	36, 45, 69, 135, 331
NlaIII	CATG	1 cut(s)	36
NlaIV	GGNNCC	1 cut(s)	128
PfeI	GAWTC	2 cut(s)	209, 345
PkrI	GCNGC	2 cut(s)	131, 236
PluTI	GGCGCC	1 cut(s)	130
PmaCI	CACGTG	1 cut(s)	123
PmlI	CACGTG	1 cut(s)	123
Ppu21I	YACGTR	1 cut(s)	123
PspCI	CACGTG	1 cut(s)	123
PspN4I	GGNNCC	1 cut(s)	128
PstI	CTGCAG	1 cut(s)	339
SalI	GTCGAC	1 cut(s)	305
SatI	GCNGC	2 cut(s)	130, 235
Sau3AI	GATC	5 cut(s)	36, 45, 69, 135, 331
ScrFI	CCNGG	1 cut(s)	77
SetI	ASST	3 cut(s)	19, 125, 196
SfaNI	GCATC	1 cut(s)	303
SfcI	CTRYAG	1 cut(s)	335
SfoI	GGCGCC	1 cut(s)	128
Sse9I	AATT	2 cut(s)	112, 164
SsiI	CCGC	1 cut(s)	130
SspDI	GGCGCC	1 cut(s)	126
SspMI	CTAG	1 cut(s)	8
StyD4I	CCNGG	1 cut(s)	75
StyI	CCWWGG	1 cut(s)	32
TaiI	ACGT	1 cut(s)	125
TaqI	TCGA	1 cut(s)	306
TasI	AATT	2 cut(s)	112, 164
TauI	GCSGC	1 cut(s)	132
TfiI	GAWTC	2 cut(s)	209, 345
TseI	GCWGC	1 cut(s)	234
XcmI	CCANNNNNNNNNTGG	1 cut(s)	101
XmiI	GTMKAC	1 cut(s)	306
XspI	CTAG	1 cut(s)	8

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.