Rroxscaffold_7G00179260

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
18887728 .. 18888724
997 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00179260.1

Sequence Viewer

Length: 255 bp
ATGACTGCGAATGCTAATCTTCTATATGATATTGACTACAACAGCATCACTAAAGTGAAGATGGAAAATGGAATGTTGGTTGACACAAAAGGCAAAGGAAGTATTGCGTTGGAAACCAAAAATGAAAAAATGTTCATTAGAGATGTAATGTTAGTTCCGGATGTTGATTCAAATTTGCTAAGTTTTGGTCAACTCATTGAGCACTCATATCACCTACAATTTGGTGACAACACTAGCAAGATCTTCGAGAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

84

Amino Acids

9.56

Weight (kDa)

5.18

Isoelectric Point (pI)

19.03

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pol_BBD PF22936 1 - 70 8.5e-14 Pol polyprotein, beta-barrel domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 157
AcsI RAATTY 1 cut(s) 172
AgsI TTSAA 1 cut(s) 171
AleI CACNNNNGTG 1 cut(s) 53
Alw21I GWGCWC 1 cut(s) 204
Aor13HI TCCGGA 1 cut(s) 157
ApoI RAATTY 1 cut(s) 172
AsuHPI GGTGA 2 cut(s) 203, 236
Bbv12I GWGCWC 1 cut(s) 204
BccI CCATC 1 cut(s) 55
BcgI CGANNNNNNTGC 1 cut(s) 226
BfaI CTAG 1 cut(s) 234
BglII AGATCT 1 cut(s) 240
BmsI GCATC 1 cut(s) 54
BsaWI WCCGGW 1 cut(s) 157
BseAI TCCGGA 1 cut(s) 157
BseGI GGATG 1 cut(s) 166
BsiHKAI GWGCWC 1 cut(s) 204
BsiSI CCGG 1 cut(s) 158
BsmI GAATGC 1 cut(s) 16
Bsp1286I GDGCHC 1 cut(s) 204
Bsp13I TCCGGA 1 cut(s) 157
Bsp143I GATC 1 cut(s) 240
BspEI TCCGGA 1 cut(s) 157
BssMI GATC 1 cut(s) 240
BstDEI CTNAG 1 cut(s) 179
BstF5I GGATG 1 cut(s) 166
BstKTI GATC 1 cut(s) 243
BstMBI GATC 1 cut(s) 240
BstX2I RGATCY 1 cut(s) 240
BstYI RGATCY 1 cut(s) 240
BtsCI GGATG 1 cut(s) 166
DdeI CTNAG 1 cut(s) 179
DpnI GATC 1 cut(s) 242
DpnII GATC 1 cut(s) 240
FaiI YATR 3 cut(s) 25, 27, 208
FokI GGATG 1 cut(s) 173
FspBI CTAG 1 cut(s) 234
HapII CCGG 1 cut(s) 158
HincII GTYRAC 2 cut(s) 82, 191
HindII GTYRAC 2 cut(s) 82, 191
HinfI GANTC 1 cut(s) 167
HpaII CCGG 1 cut(s) 158
HphI GGTGA 2 cut(s) 203, 236
Hpy166II GTNNAC 2 cut(s) 82, 191
Hpy188III TCNNGA 2 cut(s) 158, 247
Hpy8I GTNNAC 2 cut(s) 82, 191
HpyF3I CTNAG 1 cut(s) 179
Kpn2I TCCGGA 1 cut(s) 157
Kzo9I GATC 1 cut(s) 240
LpnPI CCDG 1 cut(s) 171
LweI GCATC 1 cut(s) 54
MaeI CTAG 1 cut(s) 234
MaeIII GTNAC 1 cut(s) 224
MalI GATC 1 cut(s) 242
MboI GATC 1 cut(s) 240
MboII GAAGA 3 cut(s) 11, 70, 235
MflI RGATCY 1 cut(s) 240
MhlI GDGCHC 1 cut(s) 204
MluCI AATT 2 cut(s) 172, 218
MmeI TCCRAC 1 cut(s) 90
MroI TCCGGA 1 cut(s) 157
MslI CAYNNNNRTG 1 cut(s) 53
MspI CCGG 1 cut(s) 158
Mva1269I GAATGC 1 cut(s) 16
NdeII GATC 1 cut(s) 240
NmuCI GTSAC 1 cut(s) 224
OliI CACNNNNGTG 1 cut(s) 53
PctI GAATGC 1 cut(s) 16
PfeI GAWTC 1 cut(s) 167
PsrI GAACNNNNNNTAC 2 cut(s) 138, 170
PsuI RGATCY 1 cut(s) 240
RseI CAYNNNNRTG 1 cut(s) 53
Sau3AI GATC 1 cut(s) 240
SduI GDGCHC 1 cut(s) 204
SetI ASST 1 cut(s) 216
SfaNI GCATC 1 cut(s) 54
SgeI CNNG 3 cut(s) 170, 246, 250
SmiMI CAYNNNNRTG 1 cut(s) 53
Sse9I AATT 2 cut(s) 172, 218
SspMI CTAG 1 cut(s) 234
TaqI TCGA 1 cut(s) 246
TasI AATT 2 cut(s) 172, 218
TfiI GAWTC 1 cut(s) 167
TseFI GTSAC 1 cut(s) 224
Tsp45I GTSAC 1 cut(s) 224
TspDTI ATGAA 2 cut(s) 124, 138
XapI RAATTY 1 cut(s) 172
XspI CTAG 1 cut(s) 234
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.