pycom05g10750

transposition

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
Physical Location & Seq
Forward (+)
14200456 .. 14200827
372 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g10750.1

Sequence Viewer

Length: 186 bp
ATGACCTCAGATCTCTCTAATCTCAATCTAGCAGCACCTTTTTCTGATAATGATACAGTAACAACAGACAAGATCATAAGAAGAATCATTCTTCAGGGGTTGTGTAGAGAAGGCCTCTATCCAATACCCTTTCACATTCCACAACATCTCATCATTCAAGCACAAAAACACAATGCATCATTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

6.89

Weight (kDa)

6.81

Isoelectric Point (pI)

45.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 77
AgsI TTSAA 1 cut(s) 158
AoxI GGCC 1 cut(s) 112
ApeKI GCWGC 1 cut(s) 32
BbvI GCAGC 1 cut(s) 44
BfaI CTAG 1 cut(s) 29
BglII AGATCT 1 cut(s) 10
BisI GCNGC 1 cut(s) 33
BlsI GCNGC 1 cut(s) 34
BplI GAGNNNNNCTC 2 cut(s) 99, 131
BseMII CTCAG 1 cut(s) 21
BseXI GCAGC 1 cut(s) 44
BshFI GGCC 1 cut(s) 114
BsnI GGCC 1 cut(s) 114
Bsp143I GATC 2 cut(s) 10, 72
BspANI GGCC 1 cut(s) 114
BspCNI CTCAG 1 cut(s) 20
BssMI GATC 2 cut(s) 10, 72
Bst4CI ACNGT 1 cut(s) 58
BstDEI CTNAG 1 cut(s) 7
BstKTI GATC 2 cut(s) 13, 75
BstMBI GATC 2 cut(s) 10, 72
BstV1I GCAGC 1 cut(s) 44
BstX2I RGATCY 1 cut(s) 10
BstYI RGATCY 1 cut(s) 10
BsuRI GGCC 1 cut(s) 114
CviJI RGCY 1 cut(s) 114
CviKI_1 RGCY 1 cut(s) 114
DdeI CTNAG 1 cut(s) 7
DpnI GATC 2 cut(s) 12, 74
DpnII GATC 2 cut(s) 10, 72
Eco147I AGGCCT 1 cut(s) 114
Eco57I CTGAAG 1 cut(s) 77
EcoT22I ATGCAT 1 cut(s) 178
FaiI YATR 1 cut(s) 77
Fnu4HI GCNGC 1 cut(s) 33
Fsp4HI GCNGC 1 cut(s) 33
FspBI CTAG 1 cut(s) 29
GluI GCNGC 1 cut(s) 33
HaeIII GGCC 1 cut(s) 114
HinfI GANTC 1 cut(s) 84
Hpy188I TCNGA 2 cut(s) 10, 46
HpyAV CCTTC 1 cut(s) 104
HpyCH4III ACNGT 1 cut(s) 58
HpyCH4V TGCA 1 cut(s) 176
HpyF3I CTNAG 1 cut(s) 7
Kzo9I GATC 2 cut(s) 10, 72
LpnPI CCDG 1 cut(s) 80
Lsp1109I GCAGC 1 cut(s) 44
MaeI CTAG 1 cut(s) 29
MaeIII GTNAC 1 cut(s) 58
MalI GATC 2 cut(s) 12, 74
MboI GATC 2 cut(s) 10, 72
MboII GAAGA 2 cut(s) 83, 93
MflI RGATCY 1 cut(s) 10
MnlI CCTC 2 cut(s) 16, 125
Mph1103I ATGCAT 1 cut(s) 178
NdeII GATC 2 cut(s) 10, 72
NsiI ATGCAT 1 cut(s) 178
PceI AGGCCT 1 cut(s) 114
PfeI GAWTC 1 cut(s) 84
PkrI GCNGC 1 cut(s) 34
PsuI RGATCY 1 cut(s) 10
SatI GCNGC 1 cut(s) 33
Sau3AI GATC 2 cut(s) 10, 72
SetI ASST 2 cut(s) 8, 40
SgeI CNNG 4 cut(s) 41, 82, 107, 170
SseBI AGGCCT 1 cut(s) 114
SspMI CTAG 1 cut(s) 29
StuI AGGCCT 1 cut(s) 114
TaaI ACNGT 1 cut(s) 58
TfiI GAWTC 1 cut(s) 84
TseI GCWGC 1 cut(s) 32
XspI CTAG 1 cut(s) 29
Zsp2I ATGCAT 1 cut(s) 178
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.