pycom09g02370

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Forward (+)
1790848 .. 1791138
291 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g02370.2

Sequence Viewer

Length: 210 bp
ATGGCGTCCAATTTAGAGCTATGGGAAGTTGTCAGTAGTGGGTATGTTGTACCCACTGCCGAGCAAGAAGCCGTATATACTGCGGATCAAAGGAACACTCTCAAGGACTTACGAAAGAAGGACCAAAAGGCGTTGTATCTTCTATACCAGGGTTTGGAAGATTCAACGTTCGAGAAGGTTGCAGAAGCAACAACGAGCAAGCAAGTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

70

Amino Acids

7.8

Weight (kDa)

4.76

Isoelectric Point (pI)

32.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 154
AciI CCGC 1 cut(s) 83
AclI AACGTT 1 cut(s) 167
AclWI GGATC 1 cut(s) 93
AcyI GRCGYC 1 cut(s) 5
AfaI GTAC 1 cut(s) 51
AfiI CCNNNNNNNGG 1 cut(s) 154
AgsI TTSAA 1 cut(s) 165
AjnI CCWGG 1 cut(s) 147
AluBI AGCT 1 cut(s) 19
AluI AGCT 1 cut(s) 19
AlwI GGATC 1 cut(s) 93
AspS9I GGNCC 1 cut(s) 121
AvaII GGWCC 1 cut(s) 121
BceAI ACGGC 1 cut(s) 56
BcgI CGANNNNNNTGC 2 cut(s) 161, 195
BciT130I CCWGG 1 cut(s) 149
Bme1390I CCNGG 1 cut(s) 149
Bme18I GGWCC 1 cut(s) 121
BmgT120I GGNCC 1 cut(s) 121
BmrFI CCNGG 1 cut(s) 149
BpuEI CTTGAG 1 cut(s) 86
BsaHI GRCGYC 1 cut(s) 5
BsaJI CCNNGG 1 cut(s) 148
Bsc4I CCNNNNNNNGG 1 cut(s) 154
BseBI CCWGG 1 cut(s) 149
BseDI CCNNGG 1 cut(s) 148
BseLI CCNNNNNNNGG 1 cut(s) 154
BslI CCNNNNNNNGG 1 cut(s) 154
Bsp143I GATC 1 cut(s) 85
BspACI CCGC 1 cut(s) 83
BspPI GGATC 1 cut(s) 93
BssECI CCNNGG 1 cut(s) 148
BssMI GATC 1 cut(s) 85
BssNI GRCGYC 1 cut(s) 5
Bst2UI CCWGG 1 cut(s) 149
BstACI GRCGYC 1 cut(s) 5
BstC8I GCNNGC 1 cut(s) 200
BstKTI GATC 1 cut(s) 88
BstMBI GATC 1 cut(s) 85
BstNI CCWGG 1 cut(s) 149
BstSCI CCNGG 1 cut(s) 147
BtsI GCAGTG 1 cut(s) 54
BtsIMutI CAGTG 1 cut(s) 54
Cac8I GCNNGC 1 cut(s) 200
Cfr13I GGNCC 1 cut(s) 121
Csp6I GTAC 1 cut(s) 50
CviJI RGCY 2 cut(s) 19, 71
CviKI_1 RGCY 2 cut(s) 19, 71
CviQI GTAC 1 cut(s) 50
DpnI GATC 1 cut(s) 87
DpnII GATC 1 cut(s) 85
Eco47I GGWCC 1 cut(s) 121
EcoRII CCWGG 1 cut(s) 147
FaiI YATR 6 cut(s) 22, 45, 76, 78, 145, 208
Hin1I GRCGYC 1 cut(s) 5
HinfI GANTC 1 cut(s) 161
Hpy188III TCNNGA 1 cut(s) 172
HpyAV CCTTC 2 cut(s) 112, 169
HpyCH4IV ACGT 1 cut(s) 167
HpyCH4V TGCA 1 cut(s) 182
HpySE526I ACGT 1 cut(s) 167
Hsp92I GRCGYC 1 cut(s) 5
Kzo9I GATC 1 cut(s) 85
LpnPI CCDG 2 cut(s) 134, 161
MaeII ACGT 1 cut(s) 167
MalI GATC 1 cut(s) 87
MboI GATC 1 cut(s) 85
MboII GAAGA 2 cut(s) 131, 170
MluCI AATT 1 cut(s) 10
MspR9I CCNGG 1 cut(s) 149
MvaI CCWGG 1 cut(s) 149
NdeII GATC 1 cut(s) 85
NmeAIII GCCGAG 1 cut(s) 85
PfeI GAWTC 1 cut(s) 161
PflMI CCANNNNNTGG 1 cut(s) 154
Psp1406I AACGTT 1 cut(s) 167
Psp6I CCWGG 1 cut(s) 147
PspGI CCWGG 1 cut(s) 147
PspPI GGNCC 1 cut(s) 121
RsaI GTAC 1 cut(s) 51
RsaNI GTAC 1 cut(s) 50
Sau3AI GATC 1 cut(s) 85
Sau96I GGNCC 1 cut(s) 121
ScrFI CCNGG 1 cut(s) 149
SetI ASST 3 cut(s) 21, 170, 180
SgeI CNNG 6 cut(s) 73, 77, 115, 160, 161, 184
SinI GGWCC 1 cut(s) 121
SmlI CTYRAG 1 cut(s) 101
SmoI CTYRAG 1 cut(s) 101
Sse9I AATT 1 cut(s) 10
SsiI CCGC 1 cut(s) 83
StyD4I CCNGG 1 cut(s) 147
TaiI ACGT 1 cut(s) 170
TaqI TCGA 1 cut(s) 171
TasI AATT 1 cut(s) 10
TfiI GAWTC 1 cut(s) 161
TscAI CASTG 1 cut(s) 61
TspRI CASTG 1 cut(s) 61
Van91I CCANNNNNTGG 1 cut(s) 154
VpaK11BI GGWCC 1 cut(s) 121
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.