pycom10g16330

gag-polypeptide of LTR copia-type

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
OG0002557
Physical Location & Seq
Forward (+)
19517547 .. 19517795
249 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g16330.1

Sequence Viewer

Length: 249 bp
ATGTCAAAGAACCGAATGTTCCCGTTGAAGTTGAACACAAAGATTGGGAGTTGCAACATCGGTGTGATGGAAGATGAGTCATGGAAATGGCATCTTCGATTTGGCCATCTTCATTTCAATGGCCTAAAGTTGTTGTCAAGTGGAGGAATGGTTCGTGGTTTACCCCAGATTGAAGCCACACGCCAAGTATATGAAGGTTGTGTGCTTGGCAAGCAAGCACGACTATCGTTCCCTGTTGGTGATACATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 gag_pre-integrs zf-CCHC

Protein Analysis

83

Amino Acids

9.22

Weight (kDa)

9.69

Isoelectric Point (pI)

42.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
gag_pre-integrs PF13976 6 - 72 5.3e-15 GAG-pre-integrase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 103
AgsI TTSAA 4 cut(s) 28, 34, 118, 173
AloI GAACNNNNNNTCC 2 cut(s) 135, 167
AoxI GGCC 2 cut(s) 103, 121
BalI TGGCCA 1 cut(s) 105
BccI CCATC 2 cut(s) 61, 114
BcgI CGANNNNNNTGC 2 cut(s) 207, 241
BmsI GCATC 1 cut(s) 100
BsaXI ACNNNNNCTCC 2 cut(s) 135, 165
BshFI GGCC 2 cut(s) 105, 123
BsnI GGCC 2 cut(s) 105, 123
BspANI GGCC 2 cut(s) 105, 123
BstC8I GCNNGC 2 cut(s) 212, 216
BstMWI GCNNNNNNNGC 1 cut(s) 211
BsuRI GGCC 2 cut(s) 105, 123
Cac8I GCNNGC 2 cut(s) 212, 216
CviAII CATG 1 cut(s) 81
CviJI RGCY 3 cut(s) 105, 123, 176
CviKI_1 RGCY 3 cut(s) 105, 123, 176
EaeI YGGCCR 1 cut(s) 103
FaeI CATG 1 cut(s) 84
FaiI YATR 4 cut(s) 82, 190, 192, 247
FatI CATG 1 cut(s) 80
HaeIII GGCC 2 cut(s) 105, 123
Hin1II CATG 1 cut(s) 84
HinfI GANTC 1 cut(s) 77
Hpy166II GTNNAC 1 cut(s) 161
Hpy8I GTNNAC 1 cut(s) 161
HpyAV CCTTC 1 cut(s) 188
HpyCH4V TGCA 1 cut(s) 54
HpyF10VI GCNNNNNNNGC 1 cut(s) 211
Hsp92II CATG 1 cut(s) 84
LpnPI CCDG 1 cut(s) 179
LweI GCATC 1 cut(s) 100
MboII GAAGA 3 cut(s) 83, 86, 101
MlsI TGGCCA 1 cut(s) 105
MluNI TGGCCA 1 cut(s) 105
MlyI GAGTC 1 cut(s) 86
MnlI CCTC 1 cut(s) 137
Mox20I TGGCCA 1 cut(s) 105
MscI TGGCCA 1 cut(s) 105
MslI CAYNNNNRTG 3 cut(s) 62, 85, 117
Msp20I TGGCCA 1 cut(s) 105
MwoI GCNNNNNNNGC 1 cut(s) 211
NlaIII CATG 1 cut(s) 84
PleI GAGTC 1 cut(s) 85
PpsI GAGTC 1 cut(s) 85
RseI CAYNNNNRTG 3 cut(s) 62, 85, 117
SchI GAGTC 1 cut(s) 86
SetI ASST 1 cut(s) 199
SfaNI GCATC 1 cut(s) 100
SmiMI CAYNNNNRTG 3 cut(s) 62, 85, 117
TaqI TCGA 1 cut(s) 97
TspDTI ATGAA 2 cut(s) 101, 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.