FvH4_5g18842

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
Physical Location & Seq
Forward (+)
10829744 .. 10830136
393 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g18842.t1

Sequence Viewer

Length: 393 bp
ATGAATGATGTAGCAGTTATTCCTTCATCTACTCCTTTAGAAAAGATACCTACTCCTACTCCTACAGTTATACCAGATTCTCCACCTACACTAGATTCTCAAAATGATGATGTGTGTGTAGAACAACATGAAGTGGTGTTGCCTGCTGAAGCAACACAAGAAGATGTTGAAGAAGAGATTGAAGAAGAGGTTGTTGAGGTTCAACCTCAAAGGAGGTATCCTACTCGAATTAGGAAACCTCCATCAAAGTGGGACAATTACAAGACCTTTGCTGCAAGGTATCCAATCAAAAAGTTTCTTTCTTACGACAAAGTGTCAAAATCGCATGCTGCCTTTCTCTTAAACATTTCAAGTGAAAGTGAACCAAGAACTTTTCAAGAAGCAAACCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

131

Amino Acids

14.78

Weight (kDa)

4.68

Isoelectric Point (pI)

65.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 168
AgsI TTSAA 5 cut(s) 170, 182, 203, 351, 377
AhdI GACNNNNNGTC 1 cut(s) 313
ApeKI GCWGC 2 cut(s) 272, 329
BbvI GCAGC 2 cut(s) 259, 316
BccI CCATC 1 cut(s) 250
BciVI GTATCC 2 cut(s) 228, 291
BfaI CTAG 1 cut(s) 92
BfmI CTRYAG 1 cut(s) 63
BfuI GTATCC 2 cut(s) 228, 291
BisI GCNGC 2 cut(s) 273, 330
BlsI GCNGC 2 cut(s) 274, 331
BmeRI GACNNNNNGTC 1 cut(s) 313
BsaXI ACNNNNNCTCC 2 cut(s) 43, 73
BseXI GCAGC 2 cut(s) 259, 316
BslFI GGGAC 1 cut(s) 266
BsmFI GGGAC 1 cut(s) 266
Bst4CI ACNGT 1 cut(s) 67
Bst6I CTCTTC 2 cut(s) 168, 180
BstC8I GCNNGC 2 cut(s) 144, 327
BstNSI RCATGY 1 cut(s) 329
BstSFI CTRYAG 1 cut(s) 63
BstV1I GCAGC 2 cut(s) 259, 316
BstXI CCANNNNNNTGG 1 cut(s) 249
BsuI GTATCC 2 cut(s) 228, 291
Cac8I GCNNGC 2 cut(s) 144, 327
CviAII CATG 2 cut(s) 128, 326
DriI GACNNNNNGTC 1 cut(s) 313
Eam1104I CTCTTC 2 cut(s) 168, 180
Eam1105I GACNNNNNGTC 1 cut(s) 313
EarI CTCTTC 2 cut(s) 168, 180
Eco57I CTGAAG 1 cut(s) 168
FaeI CATG 2 cut(s) 131, 329
FaiI YATR 3 cut(s) 71, 129, 327
FalI AAGNNNNNCTT 1 cut(s) 372
FaqI GGGAC 1 cut(s) 266
FatI CATG 2 cut(s) 127, 325
Fnu4HI GCNGC 2 cut(s) 273, 330
Fsp4HI GCNGC 2 cut(s) 273, 330
FspBI CTAG 1 cut(s) 92
GluI GCNGC 2 cut(s) 273, 330
Hin1II CATG 2 cut(s) 131, 329
HinfI GANTC 2 cut(s) 77, 95
Hpy166II GTNNAC 1 cut(s) 362
Hpy188III TCNNGA 1 cut(s) 377
Hpy8I GTNNAC 1 cut(s) 362
HpyAV CCTTC 1 cut(s) 33
HpyCH4III ACNGT 1 cut(s) 67
HpyCH4V TGCA 1 cut(s) 275
Hsp92II CATG 2 cut(s) 131, 329
LpnPI CCDG 2 cut(s) 87, 156
Lsp1109I GCAGC 2 cut(s) 259, 316
MaeI CTAG 1 cut(s) 92
MboII GAAGA 5 cut(s) 173, 182, 185, 194, 197
MluCI AATT 2 cut(s) 228, 256
MnlI CCTC 5 cut(s) 181, 190, 207, 216, 249
MseI TTAA 2 cut(s) 341, 391
MslI CAYNNNNRTG 1 cut(s) 247
NlaIII CATG 2 cut(s) 131, 329
NspI RCATGY 1 cut(s) 329
PaeI GCATGC 1 cut(s) 329
PfeI GAWTC 2 cut(s) 77, 95
PkrI GCNGC 2 cut(s) 274, 331
RseI CAYNNNNRTG 1 cut(s) 247
SaqAI TTAA 2 cut(s) 341, 391
SatI GCNGC 2 cut(s) 273, 330
SfcI CTRYAG 1 cut(s) 63
SmiMI CAYNNNNRTG 1 cut(s) 247
SphI GCATGC 1 cut(s) 329
Sse9I AATT 2 cut(s) 228, 256
SspMI CTAG 1 cut(s) 92
TaaI ACNGT 1 cut(s) 67
TaqI TCGA 1 cut(s) 226
TasI AATT 2 cut(s) 228, 256
TfiI GAWTC 2 cut(s) 77, 95
Tru1I TTAA 2 cut(s) 341, 391
Tru9I TTAA 2 cut(s) 341, 391
TseI GCWGC 2 cut(s) 272, 329
TspDTI ATGAA 3 cut(s) 15, 17, 144
XceI RCATGY 1 cut(s) 329
XspI CTAG 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.