FvH4_4g29520

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
Physical Location & Seq
Forward (+)
29625691 .. 29628070
2380 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g29520.t1

Sequence Viewer

Length: 321 bp
ATGGGAGGTGCCAAGGGGGGTGGTGGTGGCGGAGGAGGAGGTGCTAAAGGCGGCGGAGGAGGAGGGGCCAAAGGTGCTGGCGGAGGAGGTGCCAAAGGCGGTGGAGGAGGAGGGGCCAAAGGTGCTGGCGGCGGAGGAGCCAAAGGTGCTGGCGGCGGAGGAGCCAAAGCTGGTGGTGGAGGAGGAGGGCGAGCGTCCTCGGGTGCGAGTTCTGGTGGAGCCATGAAGGCCCCTGGAGGATCAGGCGATACAATTTCCAGGGCGGCTTTCGAAAGCAACCCTCAGGGCTACTTTCAGGGCCTCCACTCTAGTAGCAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

8.52

Weight (kDa)

10.58

Isoelectric Point (pI)

48.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 8, 89
AclWI GGATC 1 cut(s) 247
AjnI CCWGG 2 cut(s) 232, 257
AluBI AGCT 1 cut(s) 170
AluI AGCT 1 cut(s) 170
AlwI GGATC 1 cut(s) 247
Ama87I CYCGRG 1 cut(s) 199
AoxI GGCC 4 cut(s) 66, 114, 228, 298
AspS9I GGNCC 4 cut(s) 66, 114, 229, 298
AsuII TTCGAA 1 cut(s) 270
AvaI CYCGRG 1 cut(s) 199
AxyI CCTNAGG 1 cut(s) 282
BanI GGYRCC 2 cut(s) 8, 89
BciT130I CCWGG 2 cut(s) 234, 259
BfaI CTAG 1 cut(s) 309
BglI GCCNNNNNGGC 1 cut(s) 227
BisI GCNGC 4 cut(s) 52, 130, 154, 264
BlsI GCNGC 4 cut(s) 53, 131, 155, 265
Bme1390I CCNGG 2 cut(s) 234, 259
BmeT110I CYCGRG 1 cut(s) 199
BmgT120I GGNCC 4 cut(s) 66, 114, 229, 298
BmiI GGNNCC 8 cut(s) 10, 67, 91, 115, 139, 163, 220, 231
BmrFI CCNGG 2 cut(s) 234, 259
BpmI CTGGAG 1 cut(s) 255
Bpu14I TTCGAA 1 cut(s) 270
BsaJI CCNNGG 4 cut(s) 12, 198, 232, 258
Bse21I CCTNAGG 1 cut(s) 282
BseBI CCWGG 2 cut(s) 234, 259
BseDI CCNNGG 4 cut(s) 12, 198, 232, 258
BseMII CTCAG 1 cut(s) 296
BshFI GGCC 4 cut(s) 68, 116, 230, 300
BshNI GGYRCC 2 cut(s) 8, 89
BsiHKCI CYCGRG 1 cut(s) 199
BsnI GGCC 4 cut(s) 68, 116, 230, 300
BsoBI CYCGRG 1 cut(s) 199
Bsp119I TTCGAA 1 cut(s) 270
Bsp143I GATC 1 cut(s) 239
BspANI GGCC 4 cut(s) 68, 116, 230, 300
BspCNI CTCAG 1 cut(s) 295
BspLI GGNNCC 8 cut(s) 10, 67, 91, 115, 139, 163, 220, 231
BspPI GGATC 1 cut(s) 247
BspT104I TTCGAA 1 cut(s) 270
BspT107I GGYRCC 2 cut(s) 8, 89
BssECI CCNNGG 4 cut(s) 12, 198, 232, 258
BssMI GATC 1 cut(s) 239
BssT1I CCWWGG 1 cut(s) 12
Bst2UI CCWGG 2 cut(s) 234, 259
BstBI TTCGAA 1 cut(s) 270
BstC8I GCNNGC 4 cut(s) 79, 127, 151, 192
BstDEI CTNAG 1 cut(s) 282
BstKTI GATC 1 cut(s) 242
BstMBI GATC 1 cut(s) 239
BstMWI GCNNNNNNNGC 4 cut(s) 74, 122, 146, 227
BstNI CCWGG 2 cut(s) 234, 259
BstSCI CCNGG 2 cut(s) 232, 257
Bsu36I CCTNAGG 1 cut(s) 282
BsuRI GGCC 4 cut(s) 68, 116, 230, 300
Cac8I GCNNGC 4 cut(s) 79, 127, 151, 192
Cfr13I GGNCC 4 cut(s) 66, 114, 229, 298
CseI GACGC 1 cut(s) 183
CspCI CAANNNNNGTGG 5 cut(s) 36, 82, 117, 154, 189
CviAII CATG 1 cut(s) 223
DdeI CTNAG 1 cut(s) 282
DpnI GATC 1 cut(s) 241
DpnII GATC 1 cut(s) 239
EciI GGCGGA 5 cut(s) 45, 69, 96, 147, 171
Eco130I CCWWGG 1 cut(s) 12
Eco81I CCTNAGG 1 cut(s) 282
Eco88I CYCGRG 1 cut(s) 199
EcoO109I RGGNCCY 2 cut(s) 229, 298
EcoRII CCWGG 2 cut(s) 232, 257
EcoT14I CCWWGG 1 cut(s) 12
ErhI CCWWGG 1 cut(s) 12
FaeI CATG 1 cut(s) 226
FaiI YATR 1 cut(s) 224
FatI CATG 1 cut(s) 222
Fnu4HI GCNGC 4 cut(s) 52, 130, 154, 264
Fsp4HI GCNGC 4 cut(s) 52, 130, 154, 264
FspBI CTAG 1 cut(s) 309
GluI GCNGC 4 cut(s) 52, 130, 154, 264
GsuI CTGGAG 1 cut(s) 255
HaeIII GGCC 4 cut(s) 68, 116, 230, 300
HgaI GACGC 1 cut(s) 183
Hin1II CATG 1 cut(s) 226
HpyAV CCTTC 1 cut(s) 220
HpyF10VI GCNNNNNNNGC 4 cut(s) 74, 122, 146, 227
HpyF3I CTNAG 1 cut(s) 282
Hsp92II CATG 1 cut(s) 226
Kzo9I GATC 1 cut(s) 239
LmnI GCTCC 3 cut(s) 137, 161, 218
MaeI CTAG 1 cut(s) 309
MalI GATC 1 cut(s) 241
MboI GATC 1 cut(s) 239
MluCI AATT 1 cut(s) 252
MspR9I CCNGG 2 cut(s) 234, 259
MvaI CCWGG 2 cut(s) 234, 259
MwoI GCNNNNNNNGC 4 cut(s) 74, 122, 146, 227
NdeII GATC 1 cut(s) 239
NlaIII CATG 1 cut(s) 226
NlaIV GGNNCC 8 cut(s) 10, 67, 91, 115, 139, 163, 220, 231
NspV TTCGAA 1 cut(s) 270
PkrI GCNGC 4 cut(s) 53, 131, 155, 265
Psp6I CCWGG 2 cut(s) 232, 257
PspGI CCWGG 2 cut(s) 232, 257
PspN4I GGNNCC 8 cut(s) 10, 67, 91, 115, 139, 163, 220, 231
PspPI GGNCC 4 cut(s) 66, 114, 229, 298
SatI GCNGC 4 cut(s) 52, 130, 154, 264
Sau3AI GATC 1 cut(s) 239
Sau96I GGNCC 4 cut(s) 66, 114, 229, 298
ScrFI CCNGG 2 cut(s) 234, 259
SetI ASST 7 cut(s) 10, 43, 76, 91, 124, 148, 172
SfuI TTCGAA 1 cut(s) 270
Sse9I AATT 1 cut(s) 252
SspMI CTAG 1 cut(s) 309
StyD4I CCNGG 2 cut(s) 232, 257
StyI CCWWGG 1 cut(s) 12
TaqI TCGA 1 cut(s) 270
TasI AATT 1 cut(s) 252
TauI GCSGC 4 cut(s) 54, 132, 156, 266
TspDTI ATGAA 1 cut(s) 239
XspI CTAG 1 cut(s) 309
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.