Prupe.1G296800_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
29316247 .. 29316459
213 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G296800.1

Sequence Viewer

Length: 213 bp
ATGGGAGGAAGCAAAGGCTCTAATAGTAATAGCAATAGCCAGGTTGGAAATCAAAATGCTGGCTGGGGTAACTCGTCCAATGTAGCAGCAAGTGGTGGTGGCGGTGGAGGCAATGCAGCAGGGAATATGAAAGCACCTGGAAGAGATTATGCAATCTCCAGGGAGAGCTTCGAGAGCAACCCAGCTGCCTATTTCAAGGATTTGCGCAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

6.97

Weight (kDa)

9.69

Isoelectric Point (pI)

34.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 206
AciI CCGC 1 cut(s) 102
AgsI TTSAA 1 cut(s) 196
AjnI CCWGG 3 cut(s) 39, 136, 158
AluBI AGCT 2 cut(s) 168, 185
AluI AGCT 2 cut(s) 168, 185
ApeKI GCWGC 3 cut(s) 86, 116, 185
AspLEI GCGC 1 cut(s) 207
BbvI GCAGC 3 cut(s) 98, 128, 172
BciT130I CCWGG 3 cut(s) 41, 138, 160
BisI GCNGC 3 cut(s) 87, 117, 186
BlsI GCNGC 3 cut(s) 88, 118, 187
Bme1390I CCNGG 3 cut(s) 41, 138, 160
BmrFI CCNGG 3 cut(s) 41, 138, 160
BpmI CTGGAG 1 cut(s) 142
BsaJI CCNNGG 1 cut(s) 159
Bse3DI GCAATG 1 cut(s) 118
BseBI CCWGG 3 cut(s) 41, 138, 160
BseDI CCNNGG 1 cut(s) 159
BseMI GCAATG 1 cut(s) 118
BseXI GCAGC 3 cut(s) 98, 128, 172
BseYI CCCAGC 2 cut(s) 63, 181
BspACI CCGC 1 cut(s) 102
BsrDI GCAATG 1 cut(s) 118
BssECI CCNNGG 1 cut(s) 159
Bst2UI CCWGG 3 cut(s) 41, 138, 160
Bst6I CTCTTC 1 cut(s) 136
BstC8I GCNNGC 1 cut(s) 61
BstHHI GCGC 1 cut(s) 207
BstMWI GCNNNNNNNGC 2 cut(s) 108, 174
BstNI CCWGG 3 cut(s) 41, 138, 160
BstSCI CCNGG 3 cut(s) 39, 136, 158
BstV1I GCAGC 3 cut(s) 98, 128, 172
Cac8I GCNNGC 1 cut(s) 61
CfoI GCGC 1 cut(s) 207
CviJI RGCY 5 cut(s) 18, 39, 63, 168, 185
CviKI_1 RGCY 5 cut(s) 18, 39, 63, 168, 185
Eam1104I CTCTTC 1 cut(s) 136
EarI CTCTTC 1 cut(s) 136
EcoRII CCWGG 3 cut(s) 39, 136, 158
FaiI YATR 2 cut(s) 128, 150
Fnu4HI GCNGC 3 cut(s) 87, 117, 186
Fsp4HI GCNGC 3 cut(s) 87, 117, 186
FspI TGCGCA 1 cut(s) 206
GlaI GCGC 1 cut(s) 206
GluI GCNGC 3 cut(s) 87, 117, 186
GsaI CCCAGC 2 cut(s) 67, 185
GsuI CTGGAG 1 cut(s) 142
HhaI GCGC 1 cut(s) 207
Hin6I GCGC 1 cut(s) 205
HinP1I GCGC 1 cut(s) 205
Hpy188III TCNNGA 1 cut(s) 172
HpyCH4V TGCA 2 cut(s) 116, 152
HpyF10VI GCNNNNNNNGC 2 cut(s) 108, 174
HspAI GCGC 1 cut(s) 205
Lsp1109I GCAGC 3 cut(s) 98, 128, 172
MaeIII GTNAC 1 cut(s) 68
MboII GAAGA 1 cut(s) 153
MmeI TCCRAC 1 cut(s) 25
MnlI CCTC 1 cut(s) 101
MspA1I CMGCKG 1 cut(s) 185
MspR9I CCNGG 3 cut(s) 41, 138, 160
MvaI CCWGG 3 cut(s) 41, 138, 160
MwoI GCNNNNNNNGC 2 cut(s) 108, 174
NsbI TGCGCA 1 cut(s) 206
PkrI GCNGC 3 cut(s) 88, 118, 187
Psp6I CCWGG 3 cut(s) 39, 136, 158
PspFI CCCAGC 2 cut(s) 63, 181
PspGI CCWGG 3 cut(s) 39, 136, 158
PvuII CAGCTG 1 cut(s) 185
SatI GCNGC 3 cut(s) 87, 117, 186
ScrFI CCNGG 3 cut(s) 41, 138, 160
SetI ASST 4 cut(s) 45, 139, 170, 187
SsiI CCGC 1 cut(s) 102
StyD4I CCNGG 3 cut(s) 39, 136, 158
TaqI TCGA 1 cut(s) 171
TseI GCWGC 3 cut(s) 86, 116, 185
TspDTI ATGAA 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.