FvH4_4g29530

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
Physical Location & Seq
Forward (+)
29627499 .. 29628168
670 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g29530.t1

Sequence Viewer

Length: 204 bp
ATGGGAGGTGTCTTGGGTACTGGTGGTGGTTGGGGCGGAGGATGGGGTGGTGGTGGCGGAGGACAAACGTCCTCGGGTGCCAATTCTGGTGGAACCATGAAGGCCCCTGGAGGTTCAGGCGCTACAATATCCAGGGAGGTTTTCGAGAGCAACCCTAAGGGCTACTTTCAAGGCCTCCGCTCTGGTAGCAAACAGAATAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

6.34

Weight (kDa)

10.17

Isoelectric Point (pI)

51.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 77
AccBSI CCGCTC 1 cut(s) 180
AciI CCGC 3 cut(s) 36, 57, 178
AfaI GTAC 1 cut(s) 19
AgsI TTSAA 1 cut(s) 170
AjnI CCWGG 2 cut(s) 106, 131
Ama87I CYCGRG 1 cut(s) 73
AoxI GGCC 2 cut(s) 102, 172
AspLEI GCGC 1 cut(s) 122
AspS9I GGNCC 1 cut(s) 103
AvaI CYCGRG 1 cut(s) 73
AxyI CCTNAGG 1 cut(s) 156
BanI GGYRCC 1 cut(s) 77
BccI CCATC 1 cut(s) 36
BciT130I CCWGG 2 cut(s) 108, 133
BfoI RGCGCY 1 cut(s) 123
Bme1390I CCNGG 2 cut(s) 108, 133
BmeT110I CYCGRG 1 cut(s) 73
BmgT120I GGNCC 1 cut(s) 103
BmiI GGNNCC 3 cut(s) 79, 94, 105
BmrFI CCNGG 2 cut(s) 108, 133
BoxI GACNNNNGTC 1 cut(s) 67
BpmI CTGGAG 1 cut(s) 129
BsaJI CCNNGG 3 cut(s) 72, 106, 132
Bse1I ACTGG 1 cut(s) 25
Bse21I CCTNAGG 1 cut(s) 156
BseBI CCWGG 2 cut(s) 108, 133
BseDI CCNNGG 3 cut(s) 72, 106, 132
BseGI GGATG 1 cut(s) 47
BseNI ACTGG 1 cut(s) 25
BshFI GGCC 2 cut(s) 104, 174
BshNI GGYRCC 1 cut(s) 77
BsiHKCI CYCGRG 1 cut(s) 73
BsnI GGCC 2 cut(s) 104, 174
BsoBI CYCGRG 1 cut(s) 73
BspACI CCGC 3 cut(s) 36, 57, 178
BspANI GGCC 2 cut(s) 104, 174
BspLI GGNNCC 3 cut(s) 79, 94, 105
BspT107I GGYRCC 1 cut(s) 77
BsrBI CCGCTC 1 cut(s) 180
BsrI ACTGG 1 cut(s) 25
BssECI CCNNGG 3 cut(s) 72, 106, 132
Bst2UI CCWGG 2 cut(s) 108, 133
BstDEI CTNAG 1 cut(s) 156
BstF5I GGATG 1 cut(s) 47
BstH2I RGCGCY 1 cut(s) 123
BstHHI GCGC 1 cut(s) 122
BstMWI GCNNNNNNNGC 1 cut(s) 186
BstNI CCWGG 2 cut(s) 108, 133
BstPAI GACNNNNGTC 1 cut(s) 67
BstSCI CCNGG 2 cut(s) 106, 131
Bsu36I CCTNAGG 1 cut(s) 156
BsuRI GGCC 2 cut(s) 104, 174
BtsCI GGATG 1 cut(s) 47
CfoI GCGC 1 cut(s) 122
Cfr13I GGNCC 1 cut(s) 103
Csp6I GTAC 1 cut(s) 18
CspCI CAANNNNNGTGG 2 cut(s) 70, 105
CviAII CATG 1 cut(s) 97
CviJI RGCY 3 cut(s) 104, 162, 174
CviKI_1 RGCY 3 cut(s) 104, 162, 174
CviQI GTAC 1 cut(s) 18
DdeI CTNAG 1 cut(s) 156
EciI GGCGGA 2 cut(s) 51, 72
Eco147I AGGCCT 1 cut(s) 174
Eco81I CCTNAGG 1 cut(s) 156
Eco88I CYCGRG 1 cut(s) 73
EcoO109I RGGNCCY 1 cut(s) 103
EcoRII CCWGG 2 cut(s) 106, 131
FaeI CATG 1 cut(s) 100
FaiI YATR 1 cut(s) 98
FalI AAGNNNNNCTT 2 cut(s) 149, 181
FatI CATG 1 cut(s) 96
FokI GGATG 1 cut(s) 54
GlaI GCGC 1 cut(s) 121
GsuI CTGGAG 1 cut(s) 129
HaeII RGCGCY 1 cut(s) 123
HaeIII GGCC 2 cut(s) 104, 174
HhaI GCGC 1 cut(s) 122
Hin1II CATG 1 cut(s) 100
Hin6I GCGC 1 cut(s) 120
HinP1I GCGC 1 cut(s) 120
Hpy188III TCNNGA 1 cut(s) 145
HpyAV CCTTC 1 cut(s) 94
HpyCH4IV ACGT 1 cut(s) 68
HpyF10VI GCNNNNNNNGC 1 cut(s) 186
HpyF3I CTNAG 1 cut(s) 156
HpySE526I ACGT 1 cut(s) 68
Hsp92II CATG 1 cut(s) 100
HspAI GCGC 1 cut(s) 120
LpnPI CCDG 8 cut(s) 6, 72, 93, 102, 118, 120, 145, 168
MaeII ACGT 1 cut(s) 68
MbiI CCGCTC 1 cut(s) 180
MluCI AATT 1 cut(s) 82
MnlI CCTC 6 cut(s) 32, 53, 82, 104, 130, 185
MspR9I CCNGG 2 cut(s) 108, 133
MvaI CCWGG 2 cut(s) 108, 133
MwoI GCNNNNNNNGC 1 cut(s) 186
NlaIII CATG 1 cut(s) 100
NlaIV GGNNCC 3 cut(s) 79, 94, 105
PceI AGGCCT 1 cut(s) 174
PshAI GACNNNNGTC 1 cut(s) 67
Psp6I CCWGG 2 cut(s) 106, 131
PspGI CCWGG 2 cut(s) 106, 131
PspN4I GGNNCC 3 cut(s) 79, 94, 105
PspPI GGNCC 1 cut(s) 103
RsaI GTAC 1 cut(s) 19
RsaNI GTAC 1 cut(s) 18
Sau96I GGNCC 1 cut(s) 103
ScrFI CCNGG 2 cut(s) 108, 133
SetI ASST 4 cut(s) 10, 71, 115, 141
Sse9I AATT 1 cut(s) 82
SseBI AGGCCT 1 cut(s) 174
SsiI CCGC 3 cut(s) 36, 57, 178
StuI AGGCCT 1 cut(s) 174
StyD4I CCNGG 2 cut(s) 106, 131
TaiI ACGT 1 cut(s) 71
TaqI TCGA 1 cut(s) 144
TasI AATT 1 cut(s) 82
TspDTI ATGAA 1 cut(s) 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.