Prupe.1G297000_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
29319507 .. 29320271
765 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G297000.1

Sequence Viewer

Length: 222 bp
ATGGGAGGCAGCAAAGGGTCTAATGGTAATAGTAATAGCCAGGTGGGAAACCAAAATGCTGGTGGTGGAGCCAAGTCATCCAATGTAGAAGGAGCAAGTGGTGGTGGTGGAGGTGGAGGCAATGCAGCAGGGAATATGAAAGCACCTGGAAGAGATTATACGATCACCAGGGAGAGCTTTGAGAGCAACCCAGCTGCCTATTTCAAGGATTTGCGCAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

7.11

Weight (kDa)

9.6

Isoelectric Point (pI)

26.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 215
AgsI TTSAA 1 cut(s) 205
AjnI CCWGG 3 cut(s) 39, 145, 167
AluBI AGCT 2 cut(s) 177, 194
AluI AGCT 2 cut(s) 177, 194
ApeKI GCWGC 3 cut(s) 9, 125, 194
AspLEI GCGC 1 cut(s) 216
AsuHPI GGTGA 1 cut(s) 157
BarI GAAGNNNNNNTAC 2 cut(s) 142, 174
BbvI GCAGC 3 cut(s) 21, 137, 181
BciT130I CCWGG 3 cut(s) 41, 147, 169
BisI GCNGC 3 cut(s) 10, 126, 195
BlsI GCNGC 3 cut(s) 11, 127, 196
Bme1390I CCNGG 3 cut(s) 41, 147, 169
BmiI GGNNCC 1 cut(s) 70
BmrFI CCNGG 3 cut(s) 41, 147, 169
BsaJI CCNNGG 1 cut(s) 168
Bse3DI GCAATG 1 cut(s) 127
BseBI CCWGG 3 cut(s) 41, 147, 169
BseDI CCNNGG 1 cut(s) 168
BseGI GGATG 1 cut(s) 77
BseMI GCAATG 1 cut(s) 127
BseXI GCAGC 3 cut(s) 21, 137, 181
BseYI CCCAGC 1 cut(s) 190
Bsp143I GATC 1 cut(s) 162
BspLI GGNNCC 1 cut(s) 70
BsrDI GCAATG 1 cut(s) 127
BssECI CCNNGG 1 cut(s) 168
BssMI GATC 1 cut(s) 162
Bst2UI CCWGG 3 cut(s) 41, 147, 169
Bst6I CTCTTC 1 cut(s) 145
BstF5I GGATG 1 cut(s) 77
BstHHI GCGC 1 cut(s) 216
BstKTI GATC 1 cut(s) 165
BstMBI GATC 1 cut(s) 162
BstMWI GCNNNNNNNGC 1 cut(s) 183
BstNI CCWGG 3 cut(s) 41, 147, 169
BstSCI CCNGG 3 cut(s) 39, 145, 167
BstV1I GCAGC 3 cut(s) 21, 137, 181
BstXI CCANNNNNNTGG 1 cut(s) 59
BtsCI GGATG 1 cut(s) 77
CfoI GCGC 1 cut(s) 216
CviJI RGCY 4 cut(s) 39, 71, 177, 194
CviKI_1 RGCY 4 cut(s) 39, 71, 177, 194
DpnI GATC 1 cut(s) 164
DpnII GATC 1 cut(s) 162
Eam1104I CTCTTC 1 cut(s) 145
EarI CTCTTC 1 cut(s) 145
EcoRII CCWGG 3 cut(s) 39, 145, 167
FaiI YATR 2 cut(s) 137, 159
Fnu4HI GCNGC 3 cut(s) 10, 126, 195
FokI GGATG 1 cut(s) 64
Fsp4HI GCNGC 3 cut(s) 10, 126, 195
FspI TGCGCA 1 cut(s) 215
GlaI GCGC 1 cut(s) 215
GluI GCNGC 3 cut(s) 10, 126, 195
GsaI CCCAGC 1 cut(s) 194
HhaI GCGC 1 cut(s) 216
Hin6I GCGC 1 cut(s) 214
HinP1I GCGC 1 cut(s) 214
HphI GGTGA 1 cut(s) 157
HpyAV CCTTC 1 cut(s) 83
HpyCH4V TGCA 1 cut(s) 125
HpyF10VI GCNNNNNNNGC 1 cut(s) 183
HspAI GCGC 1 cut(s) 214
Kzo9I GATC 1 cut(s) 162
LmnI GCTCC 2 cut(s) 68, 92
LpnPI CCDG 9 cut(s) 26, 45, 53, 114, 132, 154, 159, 181, 204
Lsp1109I GCAGC 3 cut(s) 21, 137, 181
MalI GATC 1 cut(s) 164
MboI GATC 1 cut(s) 162
MboII GAAGA 1 cut(s) 162
MnlI CCTC 2 cut(s) 104, 110
MspA1I CMGCKG 1 cut(s) 194
MspR9I CCNGG 3 cut(s) 41, 147, 169
MvaI CCWGG 3 cut(s) 41, 147, 169
MwoI GCNNNNNNNGC 1 cut(s) 183
NdeII GATC 1 cut(s) 162
NlaIV GGNNCC 1 cut(s) 70
NsbI TGCGCA 1 cut(s) 215
PkrI GCNGC 3 cut(s) 11, 127, 196
Psp6I CCWGG 3 cut(s) 39, 145, 167
PspFI CCCAGC 1 cut(s) 190
PspGI CCWGG 3 cut(s) 39, 145, 167
PspN4I GGNNCC 1 cut(s) 70
PvuII CAGCTG 1 cut(s) 194
SatI GCNGC 3 cut(s) 10, 126, 195
Sau3AI GATC 1 cut(s) 162
ScrFI CCNGG 3 cut(s) 41, 147, 169
SetI ASST 5 cut(s) 45, 115, 148, 179, 196
StyD4I CCNGG 3 cut(s) 39, 145, 167
TseI GCWGC 3 cut(s) 9, 125, 194
TspDTI ATGAA 1 cut(s) 152
XcmI CCANNNNNNNNNTGG 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.