MD01G1042100.v1.1

Cinnamyl alcohol dehydrogenase-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
OG0002881
Physical Location & Seq
Reverse (-)
14025235 .. 14026030
796 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1042100.v1.1.491

Sequence Viewer

Length: 471 bp
ATGTCTCAAGAAATACCAGTTGCAGAAGAGCAAGCAGGGAAAGCCTATGGACGGGCCGCTAGAGATTCCTCAGGAATTCTCTCTCCGTTCCACTTCACTAGGAGTATTGGTAGTAATGATATCAGCATGAAGATACTCTATTGCGGTATTTGCCACTCAGATCTTCTCTTCGCTAAGAATGAAATTGGAATGACTATCTATCCCATTGTCCCAGGGCATGAGATTGTAGGCGAAGTGACGAAGGTTGGGTGCAATGTCACAAAATTCAAAGTAGGAAACATAGCTGGAGTTGGGTGCATGGTGGGTTCATGTCGCTCATGCGATAACTGCACACAGGACTTTGAAAATTACTGCTCTAAAATTGTGTGGACCTACAATGAACACTATGAAGACGGCTCGAGAACCTTTGGTGGATACTCGGACAAACTAGTAGTCGATGAACACTTTGCCGTCCGAATCCCAGATAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00940 ko01100 ko01110 map00940 map01100 map01110
Pfam Domains
Protein Families
ADH_N ADH_zinc_N

Protein Analysis

157

Amino Acids

17.13

Weight (kDa)

5.47

Isoelectric Point (pI)

42.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ADH_N PF08240 38 - 155 2.8e-22 Alcohol dehydrogenase GroES-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 57, 144
AcsI RAATTY 2 cut(s) 75, 263
AfiI CCNNNNNNNGG 1 cut(s) 51
AgsI TTSAA 2 cut(s) 268, 344
AhlI ACTAGT 1 cut(s) 427
AjnI CCWGG 1 cut(s) 211
AluBI AGCT 1 cut(s) 284
AluI AGCT 1 cut(s) 284
Alw26I GTCTC 1 cut(s) 9
Ama87I CYCGRG 1 cut(s) 397
AoxI GGCC 1 cut(s) 54
ApoI RAATTY 2 cut(s) 75, 263
ArsI GACNNNNNNTTYG 2 cut(s) 417, 449
AspS9I GGNCC 2 cut(s) 54, 369
AvaI CYCGRG 1 cut(s) 397
AvaII GGWCC 1 cut(s) 369
AxyI CCTNAGG 1 cut(s) 70
BbsI GAAGAC 1 cut(s) 396
BceAI ACGGC 2 cut(s) 409, 434
BciT130I CCWGG 1 cut(s) 213
BciVI GTATCC 1 cut(s) 407
BcoDI GTCTC 1 cut(s) 9
BcuI ACTAGT 1 cut(s) 427
BfaI CTAG 4 cut(s) 60, 99, 428, 469
BfuI GTATCC 1 cut(s) 407
BglII AGATCT 1 cut(s) 160
BisI GCNGC 1 cut(s) 57
BlsI GCNGC 1 cut(s) 58
Bme1390I CCNGG 1 cut(s) 213
Bme18I GGWCC 1 cut(s) 369
BmeT110I CYCGRG 1 cut(s) 397
BmgT120I GGNCC 2 cut(s) 54, 369
BmrFI CCNGG 1 cut(s) 213
BpiI GAAGAC 1 cut(s) 396
BpmI CTGGAG 1 cut(s) 306
BsaJI CCNNGG 2 cut(s) 211, 212
BsaXI ACNNNNNCTCC 2 cut(s) 94, 124
Bsc4I CCNNNNNNNGG 1 cut(s) 51
Bse1I ACTGG 1 cut(s) 17
Bse21I CCTNAGG 1 cut(s) 70
Bse3DI GCAATG 1 cut(s) 259
BseBI CCWGG 1 cut(s) 213
BseDI CCNNGG 2 cut(s) 211, 212
BseLI CCNNNNNNNGG 1 cut(s) 51
BseMI GCAATG 1 cut(s) 259
BseMII CTCAG 2 cut(s) 84, 171
BseNI ACTGG 1 cut(s) 17
BsgI GTGCAG 1 cut(s) 313
BshFI GGCC 1 cut(s) 56
BsiHKCI CYCGRG 1 cut(s) 397
BslFI GGGAC 1 cut(s) 194
BslI CCNNNNNNNGG 1 cut(s) 51
BsmAI GTCTC 1 cut(s) 9
BsmFI GGGAC 1 cut(s) 194
BsnI GGCC 1 cut(s) 56
BsoBI CYCGRG 1 cut(s) 397
Bsp143I GATC 1 cut(s) 160
BspACI CCGC 2 cut(s) 57, 144
BspANI GGCC 1 cut(s) 56
BspCNI CTCAG 2 cut(s) 83, 170
BspQI GCTCTTC 1 cut(s) 21
BsrDI GCAATG 1 cut(s) 259
BsrI ACTGG 1 cut(s) 17
BssECI CCNNGG 2 cut(s) 211, 212
BssMI GATC 1 cut(s) 160
Bst2UI CCWGG 1 cut(s) 213
Bst6I CTCTTC 2 cut(s) 21, 173
BstC8I GCNNGC 1 cut(s) 33
BstDEI CTNAG 3 cut(s) 70, 157, 174
BstKTI GATC 1 cut(s) 163
BstMAI GTCTC 1 cut(s) 9
BstMBI GATC 1 cut(s) 160
BstMWI GCNNNNNNNGC 3 cut(s) 41, 150, 327
BstNI CCWGG 1 cut(s) 213
BstSCI CCNGG 1 cut(s) 211
BstV2I GAAGAC 1 cut(s) 396
BstX2I RGATCY 1 cut(s) 160
BstYI RGATCY 1 cut(s) 160
Bsu36I CCTNAGG 1 cut(s) 70
BsuI GTATCC 1 cut(s) 407
BsuRI GGCC 1 cut(s) 56
Cac8I GCNNGC 1 cut(s) 33
Cfr13I GGNCC 2 cut(s) 54, 369
CviAII CATG 5 cut(s) 127, 218, 298, 309, 318
CviJI RGCY 4 cut(s) 44, 56, 284, 396
CviKI_1 RGCY 4 cut(s) 44, 56, 284, 396
DdeI CTNAG 3 cut(s) 70, 157, 174
DpnI GATC 1 cut(s) 162
DpnII GATC 1 cut(s) 160
Eam1104I CTCTTC 2 cut(s) 21, 173
EarI CTCTTC 2 cut(s) 21, 173
Eco32I GATATC 1 cut(s) 121
Eco47I GGWCC 1 cut(s) 369
Eco81I CCTNAGG 1 cut(s) 70
Eco88I CYCGRG 1 cut(s) 397
EcoRI GAATTC 1 cut(s) 75
EcoRII CCWGG 1 cut(s) 211
EcoRV GATATC 1 cut(s) 121
FaeI CATG 5 cut(s) 130, 221, 301, 312, 321
FaiI YATR 8 cut(s) 48, 128, 219, 281, 299, 310, 319, 387
FaqI GGGAC 1 cut(s) 194
FatI CATG 5 cut(s) 126, 217, 297, 308, 317
Fnu4HI GCNGC 1 cut(s) 57
Fsp4HI GCNGC 1 cut(s) 57
FspBI CTAG 4 cut(s) 60, 99, 428, 469
GluI GCNGC 1 cut(s) 57
GsuI CTGGAG 1 cut(s) 306
HaeIII GGCC 1 cut(s) 56
Hin1II CATG 5 cut(s) 130, 221, 301, 312, 321
HinfI GANTC 2 cut(s) 65, 456
Hpy166II GTNNAC 1 cut(s) 369
Hpy188I TCNGA 3 cut(s) 160, 421, 455
Hpy188III TCNNGA 3 cut(s) 8, 72, 399
Hpy8I GTNNAC 1 cut(s) 369
HpyAV CCTTC 1 cut(s) 235
HpyCH4V TGCA 4 cut(s) 23, 252, 297, 330
HpyF10VI GCNNNNNNNGC 3 cut(s) 41, 150, 327
HpyF3I CTNAG 3 cut(s) 70, 157, 174
Hsp92II CATG 5 cut(s) 130, 221, 301, 312, 321
Kzo9I GATC 1 cut(s) 160
LguI GCTCTTC 1 cut(s) 21
LpnPI CCDG 7 cut(s) 21, 30, 57, 198, 225, 270, 320
MaeI CTAG 4 cut(s) 60, 99, 428, 469
MaeIII GTNAC 2 cut(s) 235, 256
MalI GATC 1 cut(s) 162
MboI GATC 1 cut(s) 160
MboII GAAGA 5 cut(s) 38, 142, 155, 160, 401
MflI RGATCY 1 cut(s) 160
MluCI AATT 5 cut(s) 75, 183, 263, 346, 360
MnlI CCTC 1 cut(s) 79
MspR9I CCNGG 1 cut(s) 213
MvaI CCWGG 1 cut(s) 213
MwoI GCNNNNNNNGC 3 cut(s) 41, 150, 327
NdeII GATC 1 cut(s) 160
NlaIII CATG 5 cut(s) 130, 221, 301, 312, 321
NmuCI GTSAC 2 cut(s) 235, 256
PaeR7I CTCGAG 1 cut(s) 397
PasI CCCWGGG 1 cut(s) 212
PciSI GCTCTTC 1 cut(s) 21
PfeI GAWTC 2 cut(s) 65, 456
PkrI GCNGC 1 cut(s) 58
Psp6I CCWGG 1 cut(s) 211
PspGI CCWGG 1 cut(s) 211
PspPI GGNCC 2 cut(s) 54, 369
PsuI RGATCY 1 cut(s) 160
SapI GCTCTTC 1 cut(s) 21
SatI GCNGC 1 cut(s) 57
Sau3AI GATC 1 cut(s) 160
Sau96I GGNCC 2 cut(s) 54, 369
ScrFI CCNGG 1 cut(s) 213
SetI ASST 4 cut(s) 246, 286, 374, 407
Sfr274I CTCGAG 1 cut(s) 397
SinI GGWCC 1 cut(s) 369
SlaI CTCGAG 1 cut(s) 397
SmlI CTYRAG 2 cut(s) 6, 397
SmoI CTYRAG 2 cut(s) 6, 397
SpeI ACTAGT 1 cut(s) 427
Sse9I AATT 5 cut(s) 75, 183, 263, 346, 360
SsiI CCGC 2 cut(s) 57, 144
SspMI CTAG 4 cut(s) 60, 99, 428, 469
StyD4I CCNGG 1 cut(s) 211
TaqI TCGA 2 cut(s) 398, 435
TasI AATT 5 cut(s) 75, 183, 263, 346, 360
TauI GCSGC 1 cut(s) 59
TfiI GAWTC 2 cut(s) 65, 456
TseFI GTSAC 2 cut(s) 235, 256
Tsp45I GTSAC 2 cut(s) 235, 256
TspDTI ATGAA 6 cut(s) 143, 195, 297, 393, 402, 453
TspGWI ACGGA 1 cut(s) 75
VpaK11BI GGWCC 1 cut(s) 369
XapI RAATTY 2 cut(s) 75, 263
XhoI CTCGAG 1 cut(s) 397
XspI CTAG 4 cut(s) 60, 99, 428, 469
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.