RchiOBHm_Chr2g0110641

Dehydrogenase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0002881
Physical Location & Seq
Forward (+)
22214261 .. 22214944
684 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ48428

Sequence Viewer

Length: 423 bp
ATGAGTGAAACAATTTTATCATCTGCAGAGGGAGTGCAGGCATATGAATGGGCTGCTAGAGATTCCTCAGGAATTCTCTCTCCCTTCCACTTCACCAGGAAGACTACTGGAAGTAATGATATCAGCATGAAGATACTCTACTGTGGTATTTGCCACTCAGACCTTAACCTTGCAAAGGACGAAGTTGGAATGACCATCTATCGGTATCCCATCGTCCCAGGACATGAGATCGTCGGAGAAGTGACCGAAGTCGGAAGCAACGTCACGAAATTCAAAGTAGGAGACATAGCCGGAGTGGGGTGCATGGTGGTTTCATGTGGTTCGTGCAATAACCGCACACGAGACTTGGAAAGTTACTGCCCCAATATGGTATGGACCTATAACAAACACTACCACGACGGATCCAGAACTTTTGGGGGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00940 ko01100 ko01110 map00940 map01100 map01110
Pfam Domains
Protein Families
ADH_N ADH_zinc_N

Protein Analysis

140

Amino Acids

15.34

Weight (kDa)

5.91

Isoelectric Point (pI)

36.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ADH_N PF08240 38 - 123 3.6e-19 Alcohol dehydrogenase GroES-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 334
AclWI GGATC 2 cut(s) 396, 409
AcsI RAATTY 2 cut(s) 72, 269
AfiI CCNNNNNNNGG 4 cut(s) 175, 201, 297, 367
AgsI TTSAA 1 cut(s) 274
AjnI CCWGG 2 cut(s) 95, 217
Alw26I GTCTC 2 cut(s) 276, 336
AlwI GGATC 2 cut(s) 396, 409
ApeKI GCWGC 1 cut(s) 53
ApoI RAATTY 2 cut(s) 72, 269
AspS9I GGNCC 1 cut(s) 375
AsuHPI GGTGA 1 cut(s) 85
AvaII GGWCC 1 cut(s) 375
AxyI CCTNAGG 1 cut(s) 67
BamHI GGATCC 1 cut(s) 401
BarI GAAGNNNNNNTAC 2 cut(s) 122, 154
BauI CACGAG 1 cut(s) 339
BbsI GAAGAC 1 cut(s) 107
BbvI GCAGC 1 cut(s) 40
BccI CCATC 2 cut(s) 203, 218
BciT130I CCWGG 2 cut(s) 97, 219
BciVI GTATCC 1 cut(s) 216
BcoDI GTCTC 2 cut(s) 276, 336
BfaI CTAG 1 cut(s) 57
BfmI CTRYAG 1 cut(s) 24
BfuI GTATCC 1 cut(s) 216
BisI GCNGC 1 cut(s) 54
BlsI GCNGC 1 cut(s) 55
Bme1390I CCNGG 2 cut(s) 97, 219
Bme18I GGWCC 1 cut(s) 375
BmgT120I GGNCC 1 cut(s) 375
BmiI GGNNCC 1 cut(s) 403
BmrFI CCNGG 2 cut(s) 97, 219
BoxI GACNNNNGTC 1 cut(s) 248
BpiI GAAGAC 1 cut(s) 107
BsaJI CCNNGG 1 cut(s) 217
Bsc4I CCNNNNNNNGG 4 cut(s) 175, 201, 297, 367
Bse1I ACTGG 1 cut(s) 112
Bse21I CCTNAGG 1 cut(s) 67
BseBI CCWGG 2 cut(s) 97, 219
BseDI CCNNGG 1 cut(s) 217
BseLI CCNNNNNNNGG 4 cut(s) 175, 201, 297, 367
BseMII CTCAG 2 cut(s) 81, 171
BseNI ACTGG 1 cut(s) 112
BseXI GCAGC 1 cut(s) 40
BsgI GTGCAG 1 cut(s) 56
BsiSI CCGG 1 cut(s) 291
BslFI GGGAC 1 cut(s) 200
BslI CCNNNNNNNGG 4 cut(s) 175, 201, 297, 367
BsmAI GTCTC 2 cut(s) 276, 336
BsmFI GGGAC 1 cut(s) 200
Bsp143I GATC 2 cut(s) 228, 401
BspACI CCGC 1 cut(s) 334
BspCNI CTCAG 2 cut(s) 80, 170
BspLI GGNNCC 1 cut(s) 403
BspMAI CTGCAG 1 cut(s) 28
BspPI GGATC 2 cut(s) 396, 409
BsrI ACTGG 1 cut(s) 112
BssECI CCNNGG 1 cut(s) 217
BssMI GATC 2 cut(s) 228, 401
BssSI CACGAG 1 cut(s) 339
Bst2BI CACGAG 1 cut(s) 339
Bst2UI CCWGG 2 cut(s) 97, 219
Bst4CI ACNGT 1 cut(s) 143
BstC8I GCNNGC 1 cut(s) 39
BstDEI CTNAG 2 cut(s) 67, 157
BstENI CCTNNNNNAGG 1 cut(s) 173
BstKTI GATC 2 cut(s) 231, 404
BstMAI GTCTC 2 cut(s) 276, 336
BstMBI GATC 2 cut(s) 228, 401
BstMWI GCNNNNNNNGC 1 cut(s) 333
BstNI CCWGG 2 cut(s) 97, 219
BstPAI GACNNNNGTC 1 cut(s) 248
BstSCI CCNGG 2 cut(s) 95, 217
BstSFI CTRYAG 1 cut(s) 24
BstV1I GCAGC 1 cut(s) 40
BstV2I GAAGAC 1 cut(s) 107
BstX2I RGATCY 1 cut(s) 401
BstYI RGATCY 1 cut(s) 401
Bsu36I CCTNAGG 1 cut(s) 67
BsuI GTATCC 1 cut(s) 216
Cac8I GCNNGC 1 cut(s) 39
Cfr13I GGNCC 1 cut(s) 375
CviAII CATG 4 cut(s) 127, 224, 304, 315
CviJI RGCY 2 cut(s) 53, 290
CviKI_1 RGCY 2 cut(s) 53, 290
DdeI CTNAG 2 cut(s) 67, 157
DpnI GATC 2 cut(s) 230, 403
DpnII GATC 2 cut(s) 228, 401
Eco32I GATATC 1 cut(s) 121
Eco47I GGWCC 1 cut(s) 375
Eco81I CCTNAGG 1 cut(s) 67
EcoNI CCTNNNNNAGG 1 cut(s) 173
EcoRI GAATTC 1 cut(s) 72
EcoRII CCWGG 2 cut(s) 95, 217
EcoRV GATATC 1 cut(s) 121
FaeI CATG 4 cut(s) 130, 227, 307, 318
FaqI GGGAC 1 cut(s) 200
FatI CATG 4 cut(s) 126, 223, 303, 314
FauNDI CATATG 1 cut(s) 43
Fnu4HI GCNGC 1 cut(s) 54
Fsp4HI GCNGC 1 cut(s) 54
FspBI CTAG 1 cut(s) 57
GluI GCNGC 1 cut(s) 54
HapII CCGG 1 cut(s) 291
Hin1II CATG 4 cut(s) 130, 227, 307, 318
HinfI GANTC 1 cut(s) 62
HpaII CCGG 1 cut(s) 291
HphI GGTGA 1 cut(s) 85
Hpy188I TCNGA 3 cut(s) 160, 236, 254
Hpy188III TCNNGA 3 cut(s) 69, 265, 405
Hpy99I CGWCG 2 cut(s) 236, 401
HpyAV CCTTC 1 cut(s) 94
HpyCH4III ACNGT 1 cut(s) 143
HpyCH4IV ACGT 1 cut(s) 261
HpyCH4V TGCA 5 cut(s) 26, 37, 173, 303, 327
HpyF10VI GCNNNNNNNGC 1 cut(s) 333
HpyF3I CTNAG 2 cut(s) 67, 157
HpySE526I ACGT 1 cut(s) 261
Hsp92II CATG 4 cut(s) 130, 227, 307, 318
Kzo9I GATC 2 cut(s) 228, 401
LpnPI CCDG 9 cut(s) 23, 54, 82, 93, 109, 204, 231, 304, 418
Lsp1109I GCAGC 1 cut(s) 40
MaeI CTAG 1 cut(s) 57
MaeII ACGT 1 cut(s) 261
MaeIII GTNAC 3 cut(s) 241, 262, 353
MalI GATC 2 cut(s) 230, 403
MboI GATC 2 cut(s) 228, 401
MboII GAAGA 2 cut(s) 112, 142
MflI RGATCY 1 cut(s) 401
MluCI AATT 3 cut(s) 12, 72, 269
MmeI TCCRAC 3 cut(s) 166, 214, 232
MnlI CCTC 2 cut(s) 22, 76
MseI TTAA 1 cut(s) 165
MslI CAYNNNNRTG 1 cut(s) 46
MspI CCGG 1 cut(s) 291
MspR9I CCNGG 2 cut(s) 97, 219
MvaI CCWGG 2 cut(s) 97, 219
MwoI GCNNNNNNNGC 1 cut(s) 333
NdeI CATATG 1 cut(s) 43
NdeII GATC 2 cut(s) 228, 401
NlaIII CATG 4 cut(s) 130, 227, 307, 318
NlaIV GGNNCC 1 cut(s) 403
NmuCI GTSAC 2 cut(s) 241, 262
PcsI WCGNNNNNNNCGW 1 cut(s) 258
PfeI GAWTC 1 cut(s) 62
PkrI GCNGC 1 cut(s) 55
PshAI GACNNNNGTC 1 cut(s) 248
Psp6I CCWGG 2 cut(s) 95, 217
PspGI CCWGG 2 cut(s) 95, 217
PspN4I GGNNCC 1 cut(s) 403
PspPI GGNCC 1 cut(s) 375
PstI CTGCAG 1 cut(s) 28
PsuI RGATCY 1 cut(s) 401
RseI CAYNNNNRTG 1 cut(s) 46
SaqAI TTAA 1 cut(s) 165
SatI GCNGC 1 cut(s) 54
Sau3AI GATC 2 cut(s) 228, 401
Sau96I GGNCC 1 cut(s) 375
ScrFI CCNGG 2 cut(s) 97, 219
SetI ASST 4 cut(s) 165, 171, 264, 380
SfcI CTRYAG 1 cut(s) 24
SinI GGWCC 1 cut(s) 375
SmiMI CAYNNNNRTG 1 cut(s) 46
Sse9I AATT 3 cut(s) 12, 72, 269
SsiI CCGC 1 cut(s) 334
SspMI CTAG 1 cut(s) 57
StyD4I CCNGG 2 cut(s) 95, 217
TaaI ACNGT 1 cut(s) 143
TaiI ACGT 1 cut(s) 264
TaqII GACCGA 1 cut(s) 260
TasI AATT 3 cut(s) 12, 72, 269
TfiI GAWTC 1 cut(s) 62
Tru1I TTAA 1 cut(s) 165
Tru9I TTAA 1 cut(s) 165
TseFI GTSAC 2 cut(s) 241, 262
TseI GCWGC 1 cut(s) 53
Tsp45I GTSAC 2 cut(s) 241, 262
TspDTI ATGAA 3 cut(s) 60, 143, 303
TspGWI ACGGA 1 cut(s) 414
VpaK11BI GGWCC 1 cut(s) 375
XagI CCTNNNNNAGG 1 cut(s) 173
XapI RAATTY 2 cut(s) 72, 269
XspI CTAG 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.