Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr02

Orthogroup ID

OG0002756

Physical Location & Seq

Genomic Coordinates Forward (+)

29598627 .. 29600158

Gene Structure 1532 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD02G1245500.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 141 bp

ATGATGGGCGTGATTGATGAGATTCGAATGCCTGTTACAGAAACAAACCGAAACCCAATATTAGTTGACACAAGGACTCGTGTGAAGGATACACTTACTGTTGAACCACAACGAAGAAATGGAAGACCCTTGATGACATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Exo5

Protein Analysis

47

Amino Acids

5.35

Weight (kDa)

10.53

Isoelectric Point (pI)

45.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002756)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G57110 AT5G60370 AT5G60370
fragaria_vesca	FvH4_3g33260
malus_domestica	MD02G1245500.v1.1 MD02G1279000.v1.1 MD03G1105200.v1.1 MD03G1203800.v1.1 MD11G1130000.v1.1 MD11G1130200.v1.1 MD12G1113200.v1.1
prunus_persica	Prupe.6G094900_v2.0.a1 Prupe.6G094900_v2.0.a1
pyrus_communis	pycom01g03200 pycom11g10780
rosa_chinensis	RchiOBHm_Chr5g0060611 RchiOBHm_Chr5g0060621
rosa_laevigata	RLG00000035375 RLG00000035376
rosa_multiflora	Rmu_sc0007864.1_g000008 Rmu_sc0007864.1_g000009 Rmu_sc0020761.1_g000003 Rmu_sc0020761.1_g000004
rosa_roxburghii	Rroxscaffold_1G00020190 Rroxscaffold_1G00020200
rosa_rugosa	Rorug05G0331000 Rorug05G0331100 Rorug05G0331200 Rorug05G0331300
rosa_samantha	Rh5AG395600 Rh5AG395700 Rh5BG407900 Rh5BG408000 Rh5CG432400 Rh5CG432500 Rh5DG422800 Rh5DG422900
rosa_wichuraiana	Rw5G037220 Rw5G037230

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	104
AsuII	TTCGAA	1 cut(s)	25
BauI	CACGAG	1 cut(s)	78
BbsI	GAAGAC	1 cut(s)	130
BciVI	GTATCC	1 cut(s)	82
BfuI	GTATCC	1 cut(s)	82
BpiI	GAAGAC	1 cut(s)	130
Bpu14I	TTCGAA	1 cut(s)	25
BsmI	GAATGC	1 cut(s)	33
Bsp119I	TTCGAA	1 cut(s)	25
BspT104I	TTCGAA	1 cut(s)	25
BssSI	CACGAG	1 cut(s)	78
Bst2BI	CACGAG	1 cut(s)	78
Bst4CI	ACNGT	1 cut(s)	100
BstBI	TTCGAA	1 cut(s)	25
BstV2I	GAAGAC	1 cut(s)	130
BsuI	GTATCC	1 cut(s)	82
FaiI	YATR	1 cut(s)	139
FspEI	CC	8 cut(s)	45, 58, 62, 68, 69, 71, 105, 120
HincII	GTYRAC	1 cut(s)	67
HindII	GTYRAC	1 cut(s)	67
HinfI	GANTC	2 cut(s)	22, 76
Hpy166II	GTNNAC	1 cut(s)	67
Hpy8I	GTNNAC	1 cut(s)	67
HpyAV	CCTTC	1 cut(s)	79
HpyCH4III	ACNGT	1 cut(s)	100
LpnPI	CCDG	1 cut(s)	45
MaeIII	GTNAC	1 cut(s)	34
MboII	GAAGA	2 cut(s)	126, 135
MlyI	GAGTC	1 cut(s)	70
Mva1269I	GAATGC	1 cut(s)	33
NspV	TTCGAA	1 cut(s)	25
PctI	GAATGC	1 cut(s)	33
PfeI	GAWTC	1 cut(s)	22
PleI	GAGTC	1 cut(s)	70
PpsI	GAGTC	1 cut(s)	70
SchI	GAGTC	1 cut(s)	70
SfuI	TTCGAA	1 cut(s)	25
SgeI	CNNG	5 cut(s)	22, 44, 84, 90, 92
SspI	AATATT	1 cut(s)	60
TaaI	ACNGT	1 cut(s)	100
TaqI	TCGA	1 cut(s)	25
TfiI	GAWTC	1 cut(s)	22

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.