Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr02

Orthogroup ID

OG0003476

Physical Location & Seq

Genomic Coordinates Forward (+)

35697093 .. 35698545

Gene Structure 1453 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD02G1303100.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 204 bp

ATGATGTCGGCCAACACATACCTACCCTGGCGTTTGGAGAACATCGGAATCGGGGCGTATTTACTAGAAGAAGGATCTTTCGACGCTATAGTTGATGGATGTGTTGGTGTTTTTCATACAGCATCTCCTGCTCAATTTTCAGTCACTGACCCACAGGTTTGTCCTTTCACTTCATGCTTCAAATATTCCAACATGTGTTGTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

68

Amino Acids

7.34

Weight (kDa)

4.29

Isoelectric Point (pI)

38.02

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003476)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g01511 FvH4_7g01562
malus_domestica	MD02G1303100.v1.1 MD02G1303600.v1.1 MD02G1305000.v1.1 MD07G1021100.v1.1
pyrus_communis	pycom03g13000
rosa_chinensis	RchiOBHm_Chr1g0317491 RchiOBHm_Chr1g0317571 RchiOBHm_Chr1g0317671 RchiOBHm_Chr1g0339871 RchiOBHm_Chr1g0350261 RchiOBHm_Chr6g0278881
rosa_laevigata	RLG00000008039 RLG00000018453
rosa_multiflora	Rmu_sc0001037.1_g000008
rosa_roxburghii	Rroxscaffold_3G00227970 Rroxscaffold_7G00208320
rosa_rugosa	Rorug04G0048200
rosa_samantha	Rh1AG027600 Rh1AG027700 Rh1AG028100 Rh1AG028200 Rh1AG028500 Rh1AG028600 Rh1AG028800 Rh1AG029000 Rh1BG023500 Rh1BG065400 Rh2AG270400 Rh2BG281800 Rh2DG278200 Rh6BG365600 Rh6CG236400 Rh6DG227600
rosa_wichuraiana	Rw0G018780

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	82
AcoI	YGGCCR	1 cut(s)	9
AflIII	ACRYGT	1 cut(s)	192
AgsI	TTSAA	1 cut(s)	181
AjnI	CCWGG	1 cut(s)	26
AlwI	GGATC	1 cut(s)	82
AlwNI	CAGNNNCTG	1 cut(s)	146
AoxI	GGCC	1 cut(s)	9
BccI	CCATC	1 cut(s)	89
BciT130I	CCWGG	1 cut(s)	28
BfaI	CTAG	1 cut(s)	65
BfmI	CTRYAG	1 cut(s)	87
Bme1390I	CCNGG	1 cut(s)	28
BmrFI	CCNGG	1 cut(s)	28
BmsI	GCATC	1 cut(s)	131
BsaJI	CCNNGG	1 cut(s)	26
BsaXI	ACNNNNNCTCC	2 cut(s)	109, 139
BseBI	CCWGG	1 cut(s)	28
BseDI	CCNNGG	1 cut(s)	26
BseGI	GGATG	1 cut(s)	104
BshFI	GGCC	1 cut(s)	11
BsnI	GGCC	1 cut(s)	11
Bsp143I	GATC	1 cut(s)	74
BspANI	GGCC	1 cut(s)	11
BspPI	GGATC	1 cut(s)	82
BssECI	CCNNGG	1 cut(s)	26
BssMI	GATC	1 cut(s)	74
Bst2UI	CCWGG	1 cut(s)	28
BstAPI	GCANNNNNTGC	1 cut(s)	128
BstF5I	GGATG	1 cut(s)	104
BstKTI	GATC	1 cut(s)	77
BstMBI	GATC	1 cut(s)	74
BstMWI	GCNNNNNNNGC	1 cut(s)	128
BstNI	CCWGG	1 cut(s)	28
BstNSI	RCATGY	1 cut(s)	196
BstSCI	CCNGG	1 cut(s)	26
BstSFI	CTRYAG	1 cut(s)	87
BstX2I	RGATCY	1 cut(s)	74
BstYI	RGATCY	1 cut(s)	74
BsuRI	GGCC	1 cut(s)	11
BtsCI	GGATG	1 cut(s)	104
BtsIMutI	CAGTG	1 cut(s)	144
CaiI	CAGNNNCTG	1 cut(s)	146
CseI	GACGC	1 cut(s)	92
CviAII	CATG	2 cut(s)	174, 193
CviJI	RGCY	1 cut(s)	11
CviKI_1	RGCY	1 cut(s)	11
DpnI	GATC	1 cut(s)	76
DpnII	GATC	1 cut(s)	74
EaeI	YGGCCR	1 cut(s)	9
EcoRII	CCWGG	1 cut(s)	26
FaeI	CATG	2 cut(s)	177, 196
FaiI	YATR	5 cut(s)	19, 89, 117, 175, 194
FatI	CATG	2 cut(s)	173, 192
FokI	GGATG	1 cut(s)	111
FspBI	CTAG	1 cut(s)	65
HaeIII	GGCC	1 cut(s)	11
HgaI	GACGC	1 cut(s)	92
Hin1II	CATG	2 cut(s)	177, 196
HinfI	GANTC	1 cut(s)	48
Hpy188I	TCNGA	1 cut(s)	47
Hpy99I	CGWCG	1 cut(s)	86
HpyAV	CCTTC	1 cut(s)	65
HpyF10VI	GCNNNNNNNGC	1 cut(s)	128
Hsp92II	CATG	2 cut(s)	177, 196
Kzo9I	GATC	1 cut(s)	74
LpnPI	CCDG	4 cut(s)	13, 40, 140, 141
LweI	GCATC	1 cut(s)	131
MaeI	CTAG	1 cut(s)	65
MaeIII	GTNAC	1 cut(s)	142
MalI	GATC	1 cut(s)	76
MboI	GATC	1 cut(s)	74
MboII	GAAGA	1 cut(s)	80
MflI	RGATCY	1 cut(s)	74
MluCI	AATT	1 cut(s)	134
MspR9I	CCNGG	1 cut(s)	28
MvaI	CCWGG	1 cut(s)	28
MwoI	GCNNNNNNNGC	1 cut(s)	128
NdeII	GATC	1 cut(s)	74
NlaIII	CATG	2 cut(s)	177, 196
NmuCI	GTSAC	1 cut(s)	142
NspI	RCATGY	1 cut(s)	196
PciI	ACATGT	1 cut(s)	192
PfeI	GAWTC	1 cut(s)	48
PscI	ACATGT	1 cut(s)	192
Psp6I	CCWGG	1 cut(s)	26
PspGI	CCWGG	1 cut(s)	26
PstNI	CAGNNNCTG	1 cut(s)	146
PsuI	RGATCY	1 cut(s)	74
Sau3AI	GATC	1 cut(s)	74
ScrFI	CCNGG	1 cut(s)	28
SetI	ASST	2 cut(s)	24, 159
SfaNI	GCATC	1 cut(s)	131
SfcI	CTRYAG	1 cut(s)	87
SgeI	CNNG	7 cut(s)	39, 40, 64, 77, 140, 167, 186
Sse9I	AATT	1 cut(s)	134
SspI	AATATT	1 cut(s)	185
SspMI	CTAG	1 cut(s)	65
StyD4I	CCNGG	1 cut(s)	26
TaqI	TCGA	1 cut(s)	81
TasI	AATT	1 cut(s)	134
TfiI	GAWTC	1 cut(s)	48
TscAI	CASTG	1 cut(s)	151
TseFI	GTSAC	1 cut(s)	142
Tsp45I	GTSAC	1 cut(s)	142
TspDTI	ATGAA	2 cut(s)	104, 162
TspRI	CASTG	1 cut(s)	151
XceI	RCATGY	1 cut(s)	196
XspI	CTAG	1 cut(s)	65

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.