Rh6BG365600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
59450769 .. 59451845
1077 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG365600.1

Sequence Viewer

Length: 189 bp
ATGGAGCTGAAACCAGGTCTCTCAGCTCTCGTCACCGACGGAGCTTCTGGAATTACTGCTAATGCTAGAAAAATTCTGAAAAGAGAGAGGTTTAAGATGACAATATACAAACCGGAGGGTGGGAATGTAAACATCTACAAGCAGTTCAAGTTATACCATTCAGGTCCGGCTTTCAGCCAGAAATTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.91

Weight (kDa)

10.07

Isoelectric Point (pI)

26.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 72
AfiI CCNNNNNNNGG 1 cut(s) 119
AgsI TTSAA 1 cut(s) 148
AjnI CCWGG 1 cut(s) 13
AluBI AGCT 3 cut(s) 7, 26, 44
AluI AGCT 3 cut(s) 7, 26, 44
Alw26I GTCTC 1 cut(s) 23
ApoI RAATTY 1 cut(s) 72
AspS9I GGNCC 1 cut(s) 164
AsuHPI GGTGA 1 cut(s) 25
AvaII GGWCC 1 cut(s) 164
BciT130I CCWGG 1 cut(s) 15
BcoDI GTCTC 1 cut(s) 23
BfaI CTAG 1 cut(s) 66
Bme1390I CCNGG 1 cut(s) 15
Bme18I GGWCC 1 cut(s) 164
BmgT120I GGNCC 1 cut(s) 164
BmrFI CCNGG 1 cut(s) 15
BsaI GGTCTC 1 cut(s) 23
BsaWI WCCGGW 1 cut(s) 112
Bsc4I CCNNNNNNNGG 1 cut(s) 119
BseBI CCWGG 1 cut(s) 15
BseLI CCNNNNNNNGG 1 cut(s) 119
BseMII CTCAG 1 cut(s) 36
BsiSI CCGG 2 cut(s) 113, 167
BslI CCNNNNNNNGG 1 cut(s) 119
BsmAI GTCTC 1 cut(s) 23
Bso31I GGTCTC 1 cut(s) 23
BspCNI CTCAG 1 cut(s) 35
BspTNI GGTCTC 1 cut(s) 23
Bst2UI CCWGG 1 cut(s) 15
BstDEI CTNAG 1 cut(s) 22
BstMAI GTCTC 1 cut(s) 23
BstNI CCWGG 1 cut(s) 15
BstSCI CCNGG 1 cut(s) 13
Cfr13I GGNCC 1 cut(s) 164
CsiI ACCWGGT 1 cut(s) 13
CviJI RGCY 5 cut(s) 7, 26, 44, 170, 177
CviKI_1 RGCY 5 cut(s) 7, 26, 44, 170, 177
DdeI CTNAG 1 cut(s) 22
Eco31I GGTCTC 1 cut(s) 23
Eco47I GGWCC 1 cut(s) 164
EcoRII CCWGG 1 cut(s) 13
FaiI YATR 2 cut(s) 106, 154
FspBI CTAG 1 cut(s) 66
HapII CCGG 2 cut(s) 113, 167
HpaII CCGG 2 cut(s) 113, 167
HphI GGTGA 1 cut(s) 25
Hpy166II GTNNAC 1 cut(s) 130
Hpy188I TCNGA 1 cut(s) 78
Hpy188III TCNNGA 1 cut(s) 48
Hpy8I GTNNAC 1 cut(s) 130
Hpy99I CGWCG 1 cut(s) 41
HpyF3I CTNAG 1 cut(s) 22
LmnI GCTCC 2 cut(s) 4, 41
LpnPI CCDG 5 cut(s) 27, 33, 126, 147, 180
MabI ACCWGGT 1 cut(s) 13
MaeI CTAG 1 cut(s) 66
MaeIII GTNAC 1 cut(s) 31
MluCI AATT 3 cut(s) 51, 72, 182
MnlI CCTC 2 cut(s) 81, 109
MseI TTAA 1 cut(s) 93
MspI CCGG 2 cut(s) 113, 167
MspR9I CCNGG 1 cut(s) 15
MvaI CCWGG 1 cut(s) 15
NmuCI GTSAC 1 cut(s) 31
Psp6I CCWGG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 13
PspPI GGNCC 1 cut(s) 164
SaqAI TTAA 1 cut(s) 93
Sau96I GGNCC 1 cut(s) 164
ScrFI CCNGG 1 cut(s) 15
SetI ASST 6 cut(s) 9, 19, 28, 46, 92, 166
SexAI ACCWGGT 1 cut(s) 13
SinI GGWCC 1 cut(s) 164
Sse9I AATT 3 cut(s) 51, 72, 182
SspMI CTAG 1 cut(s) 66
StyD4I CCNGG 1 cut(s) 13
TasI AATT 3 cut(s) 51, 72, 182
Tru1I TTAA 1 cut(s) 93
Tru9I TTAA 1 cut(s) 93
TseFI GTSAC 1 cut(s) 31
Tsp45I GTSAC 1 cut(s) 31
TspGWI ACGGA 1 cut(s) 54
VpaK11BI GGWCC 1 cut(s) 164
XapI RAATTY 1 cut(s) 72
XspI CTAG 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.