RchiOBHm_Chr6g0278881

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
41951418 .. 41951753
336 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ25015

Sequence Viewer

Length: 336 bp
ATGAATTATATCATGCAAGTTGGATTGTATAAACTTAAATTTTGTTCAAAAGTTTCAATGTTGGATTCTATATCCTACACTTTCCTTAACTCTTTGATATCTTTAGCATGGTCTACTCATAATGGTACTAACTGTAGTGGAAGCAACTCTGGTAGTGTTCATAGAGATAGATTGCCATTGGGACAAAGTGTTGCTTGGTTAACAATATTGAATATTGTTTCAGTAATATCTACAAGGGTTTTCACCCTGCTTGTTTACCCAATAAAGTTAACATGTTTTATCATGCCTACATGGGATCTTCCACTTGACTTAACCGGTGATCTTGAGGGTCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

111

Amino Acids

12.35

Weight (kDa)

7.73

Isoelectric Point (pI)

19.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 113
AclWI GGATC 1 cut(s) 303
AcsI RAATTY 1 cut(s) 38
AfaI GTAC 1 cut(s) 127
AflIII ACRYGT 1 cut(s) 272
AgeI ACCGGT 1 cut(s) 314
AgsI TTSAA 3 cut(s) 48, 57, 211
AlwI GGATC 1 cut(s) 303
ApoI RAATTY 1 cut(s) 38
AsiGI ACCGGT 1 cut(s) 314
AsuHPI GGTGA 2 cut(s) 235, 329
BfmI CTRYAG 1 cut(s) 133
BsaWI WCCGGW 1 cut(s) 314
Bse118I RCCGGY 1 cut(s) 314
BshTI ACCGGT 1 cut(s) 314
BsiSI CCGG 1 cut(s) 315
BslFI GGGAC 1 cut(s) 195
BsmFI GGGAC 1 cut(s) 195
Bsp143I GATC 2 cut(s) 295, 319
BspPI GGATC 1 cut(s) 303
BsrFI RCCGGY 1 cut(s) 314
BssAI RCCGGY 1 cut(s) 314
BssMI GATC 2 cut(s) 295, 319
Bst4CI ACNGT 1 cut(s) 134
BstKTI GATC 2 cut(s) 298, 322
BstMBI GATC 2 cut(s) 295, 319
BstNSI RCATGY 1 cut(s) 276
BstSFI CTRYAG 1 cut(s) 133
BstX2I RGATCY 1 cut(s) 295
BstYI RGATCY 1 cut(s) 295
Cfr10I RCCGGY 1 cut(s) 314
Csp6I GTAC 1 cut(s) 126
CspAI ACCGGT 1 cut(s) 314
CviAII CATG 5 cut(s) 13, 108, 273, 283, 291
CviQI GTAC 1 cut(s) 126
DpnI GATC 2 cut(s) 297, 321
DpnII GATC 2 cut(s) 295, 319
Eco32I GATATC 1 cut(s) 99
EcoRV GATATC 1 cut(s) 99
FaeI CATG 5 cut(s) 16, 111, 276, 286, 294
FalI AAGNNNNNCTT 2 cut(s) 178, 210
FaqI GGGAC 1 cut(s) 195
FatI CATG 5 cut(s) 12, 107, 272, 282, 290
FblI GTMKAC 1 cut(s) 113
HapII CCGG 1 cut(s) 315
Hin1II CATG 5 cut(s) 16, 111, 276, 286, 294
HincII GTYRAC 2 cut(s) 201, 270
HindII GTYRAC 2 cut(s) 201, 270
HinfI GANTC 1 cut(s) 65
HpaI GTTAAC 2 cut(s) 201, 270
HpaII CCGG 1 cut(s) 315
HphI GGTGA 2 cut(s) 235, 329
Hpy166II GTNNAC 4 cut(s) 114, 201, 256, 270
Hpy188III TCNNGA 1 cut(s) 323
Hpy8I GTNNAC 4 cut(s) 114, 201, 256, 270
HpyCH4III ACNGT 1 cut(s) 134
HpyCH4V TGCA 1 cut(s) 16
Hsp92II CATG 5 cut(s) 16, 111, 276, 286, 294
KspAI GTTAAC 2 cut(s) 201, 270
Kzo9I GATC 2 cut(s) 295, 319
LpnPI CCDG 3 cut(s) 135, 260, 328
MalI GATC 2 cut(s) 297, 321
MboI GATC 2 cut(s) 295, 319
MboII GAAGA 1 cut(s) 290
MflI RGATCY 1 cut(s) 295
MluCI AATT 2 cut(s) 4, 38
MmeI TCCRAC 1 cut(s) 42
MnlI CCTC 1 cut(s) 319
MseI TTAA 5 cut(s) 36, 87, 200, 269, 311
MspI CCGG 1 cut(s) 315
NdeII GATC 2 cut(s) 295, 319
NlaIII CATG 5 cut(s) 16, 111, 276, 286, 294
NspI RCATGY 1 cut(s) 276
PciI ACATGT 1 cut(s) 272
PfeI GAWTC 1 cut(s) 65
PinAI ACCGGT 1 cut(s) 314
PscI ACATGT 1 cut(s) 272
PsuI RGATCY 1 cut(s) 295
RsaI GTAC 1 cut(s) 127
RsaNI GTAC 1 cut(s) 126
SaqAI TTAA 5 cut(s) 36, 87, 200, 269, 311
Sau3AI GATC 2 cut(s) 295, 319
SfcI CTRYAG 1 cut(s) 133
SmlI CTYRAG 1 cut(s) 323
SmoI CTYRAG 1 cut(s) 323
Sse9I AATT 2 cut(s) 4, 38
SspI AATATT 2 cut(s) 207, 214
TaaI ACNGT 1 cut(s) 134
TasI AATT 2 cut(s) 4, 38
TfiI GAWTC 1 cut(s) 65
Tru1I TTAA 5 cut(s) 36, 87, 200, 269, 311
Tru9I TTAA 5 cut(s) 36, 87, 200, 269, 311
TspDTI ATGAA 2 cut(s) 17, 149
XapI RAATTY 1 cut(s) 38
XceI RCATGY 1 cut(s) 276
XmiI GTMKAC 1 cut(s) 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.