MD04G1038700.v1.1

IST1 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
OG0003928
Physical Location & Seq
Forward (+)
4274138 .. 4274890
753 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1038700.v1.1.491

Sequence Viewer

Length: 300 bp
ATGAGTTCATTGAGTGAATTAGTAGAATCTAGACCTTCTATCATCACAAAGCGAAGGGAGTGTCCGCCTTATCTCAAAGAAGGAATTGCTAGTTTAATCTTGGCCTCTCCCAGGTGTTCTGAGATTTCTGAACTGATCGCACTAAGGGATATTTTTGAAAAAAAGTACAGTAAAGATTTTGTATATGCGGATGTTGATGTACGTCCCAGCTGTTGTGTGAATCGCATGTTGCTTGACAAGCATTGCTCAACTTTGAGGGTGGAGCAAGGTTCATTGACCTGGGAGAGTGGCAGTGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04144 map04144
Pfam Domains
Protein Families
Ist1

Protein Analysis

100

Amino Acids

11.21

Weight (kDa)

5.87

Isoelectric Point (pI)

65.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ist1 PF03398 5 - 81 5.2e-17 Regulator of Vps4 activity in the MVB pathway
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 65, 188
AfaI GTAC 2 cut(s) 167, 201
AfiI CCNNNNNNNGG 1 cut(s) 111
AgsI TTSAA 1 cut(s) 158
AjnI CCWGG 2 cut(s) 110, 278
AluBI AGCT 1 cut(s) 210
AluI AGCT 1 cut(s) 210
AoxI GGCC 1 cut(s) 102
ArsI GACNNNNNNTTYG 2 cut(s) 46, 78
BciT130I CCWGG 2 cut(s) 112, 280
BfaI CTAG 2 cut(s) 30, 90
Bme1390I CCNGG 2 cut(s) 112, 280
BmrFI CCNGG 2 cut(s) 112, 280
BsaJI CCNNGG 2 cut(s) 110, 279
Bsc4I CCNNNNNNNGG 1 cut(s) 111
Bse3DI GCAATG 1 cut(s) 241
BseBI CCWGG 2 cut(s) 112, 280
BseDI CCNNGG 2 cut(s) 110, 279
BseGI GGATG 1 cut(s) 196
BseLI CCNNNNNNNGG 1 cut(s) 111
BseMI GCAATG 1 cut(s) 241
BseMII CTCAG 1 cut(s) 111
BseYI CCCAGC 1 cut(s) 206
BshFI GGCC 1 cut(s) 104
BslFI GGGAC 1 cut(s) 189
BslI CCNNNNNNNGG 1 cut(s) 111
BsmFI GGGAC 1 cut(s) 189
BsnI GGCC 1 cut(s) 104
Bsp143I GATC 1 cut(s) 135
BspACI CCGC 2 cut(s) 65, 188
BspANI GGCC 1 cut(s) 104
BspCNI CTCAG 1 cut(s) 112
BsrDI GCAATG 1 cut(s) 241
BssECI CCNNGG 2 cut(s) 110, 279
BssMI GATC 1 cut(s) 135
Bst2UI CCWGG 2 cut(s) 112, 280
Bst4CI ACNGT 1 cut(s) 170
BstDEI CTNAG 2 cut(s) 120, 143
BstENI CCTNNNNNAGG 1 cut(s) 109
BstF5I GGATG 1 cut(s) 196
BstKTI GATC 1 cut(s) 138
BstMBI GATC 1 cut(s) 135
BstMWI GCNNNNNNNGC 1 cut(s) 238
BstNI CCWGG 2 cut(s) 112, 280
BstNSI RCATGY 1 cut(s) 229
BstSCI CCNGG 2 cut(s) 110, 278
BsuRI GGCC 1 cut(s) 104
BtsCI GGATG 1 cut(s) 196
BtsI GCAGTG 1 cut(s) 298
BtsIMutI CAGTG 1 cut(s) 298
Csp6I GTAC 2 cut(s) 166, 200
CviAII CATG 1 cut(s) 226
CviJI RGCY 2 cut(s) 104, 210
CviKI_1 RGCY 2 cut(s) 104, 210
CviQI GTAC 2 cut(s) 166, 200
DdeI CTNAG 2 cut(s) 120, 143
DpnI GATC 1 cut(s) 137
DpnII GATC 1 cut(s) 135
EciI GGCGGA 1 cut(s) 54
EcoNI CCTNNNNNAGG 1 cut(s) 109
EcoRII CCWGG 2 cut(s) 110, 278
FaeI CATG 1 cut(s) 229
FaiI YATR 3 cut(s) 184, 186, 227
FaqI GGGAC 1 cut(s) 189
FatI CATG 1 cut(s) 225
FokI GGATG 1 cut(s) 203
FspBI CTAG 2 cut(s) 30, 90
GsaI CCCAGC 1 cut(s) 210
HaeIII GGCC 1 cut(s) 104
Hin1II CATG 1 cut(s) 229
HinfI GANTC 2 cut(s) 26, 220
Hpy188I TCNGA 2 cut(s) 121, 130
Hpy188III TCNNGA 1 cut(s) 30
HpyAV CCTTC 3 cut(s) 45, 48, 74
HpyCH4III ACNGT 1 cut(s) 170
HpyCH4IV ACGT 1 cut(s) 202
HpyF10VI GCNNNNNNNGC 1 cut(s) 238
HpyF3I CTNAG 2 cut(s) 120, 143
HpySE526I ACGT 1 cut(s) 202
Hsp92II CATG 1 cut(s) 229
Kzo9I GATC 1 cut(s) 135
LmnI GCTCC 1 cut(s) 262
LpnPI CCDG 5 cut(s) 97, 124, 220, 265, 292
MaeI CTAG 2 cut(s) 30, 90
MaeII ACGT 1 cut(s) 202
MalI GATC 1 cut(s) 137
MboI GATC 1 cut(s) 135
MluCI AATT 2 cut(s) 17, 84
MnlI CCTC 2 cut(s) 115, 249
MseI TTAA 1 cut(s) 95
MspA1I CMGCKG 1 cut(s) 210
MspR9I CCNGG 2 cut(s) 112, 280
MvaI CCWGG 2 cut(s) 112, 280
MwoI GCNNNNNNNGC 1 cut(s) 238
NdeII GATC 1 cut(s) 135
NlaIII CATG 1 cut(s) 229
NspI RCATGY 1 cut(s) 229
PfeI GAWTC 2 cut(s) 26, 220
Psp6I CCWGG 2 cut(s) 110, 278
PspFI CCCAGC 1 cut(s) 206
PspGI CCWGG 2 cut(s) 110, 278
PvuII CAGCTG 1 cut(s) 210
RsaI GTAC 2 cut(s) 167, 201
RsaNI GTAC 2 cut(s) 166, 200
SaqAI TTAA 1 cut(s) 95
Sau3AI GATC 1 cut(s) 135
ScrFI CCNGG 2 cut(s) 112, 280
SetI ASST 6 cut(s) 37, 116, 205, 212, 271, 281
Sse9I AATT 2 cut(s) 17, 84
SsiI CCGC 2 cut(s) 65, 188
SspMI CTAG 2 cut(s) 30, 90
StyD4I CCNGG 2 cut(s) 110, 278
TaaI ACNGT 1 cut(s) 170
TaiI ACGT 1 cut(s) 205
TasI AATT 2 cut(s) 17, 84
TatI WGTACW 1 cut(s) 165
TfiI GAWTC 2 cut(s) 26, 220
Tru1I TTAA 1 cut(s) 95
Tru9I TTAA 1 cut(s) 95
TscAI CASTG 1 cut(s) 298
TspDTI ATGAA 1 cut(s) 261
TspRI CASTG 1 cut(s) 298
XagI CCTNNNNNAGG 1 cut(s) 109
XbaI TCTAGA 1 cut(s) 29
XceI RCATGY 1 cut(s) 229
XspI CTAG 2 cut(s) 30, 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.