Rmu_sc0034225.1_g000001

IST1 homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0034225.1
Physical Location & Seq
Forward (+)
1 .. 1393
1393 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0034225.1_g000001.1.cds

Sequence Viewer

Length: 931 bp
gctgtctgttagaacccctacgggtgaagtaaagctgaaaatcatgaaggaaatagcgaaggaataccaggttgattgggacacaacagaatctgaacaagaacttctcaaacctccagaagagactctagatggaccgcgtacttttgttagtgctaccagcttgcctgtgacaacccaattttttgagtctaacaagtcagaaacaaggctttcttccagttcgttgcgcagaacaagtggtggtggacagagggaaaccagttctacgcgcagaatgagtgatggtggagaaagggaaactagttcctttcgcagaacaagcggtggtggagaaagagaaaccagaacaagtggtggtggagaaaagggacatttgcaatttgcagactcggcatcagctgccgcagcagctgcaaaatctgccagtgatgcaatggcggctgcacaagtggctgcatttctggccaacaaagactccaatcgggcatctgctaatgaatttaaaaccctttcgagcaattccaccggccaacaaggaccagatagtccatctcttgactcttatgacatggatcatcaatatgaagctgagggaaaaacacactgggcggagagtttggacaggtcatattcttcaaacaatgacgttaaccatggaggagaggtgaagaattttgtctatagaagatacagctacaatgctgcaccatcagaaaattcaggtatgaagtttgatgaatcagacaccgatgaagggattgaaatggaagcacctcctagtgggaattatcaagggcctgagcgtcctccaccaccagtaccttcggcaactgttcggcaggactcacttcatcgcgttcatcccaaattgcctgattacgatacacttgctgctcgctttgatgcccttaagcatcatcacaaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

309

Amino Acids

33.72

Weight (kDa)

5.47

Isoelectric Point (pI)

49.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 547
Acc16I TGCGCA 1 cut(s) 231
AccII CGCG 3 cut(s) 140, 272, 859
AciI CCGC 5 cut(s) 138, 325, 406, 441, 612
AclWI GGATC 1 cut(s) 583
AcoI YGGCCR 2 cut(s) 466, 530
AcsI RAATTY 3 cut(s) 501, 674, 719
AfaI GTAC 2 cut(s) 143, 823
AfiI CCNNNNNNNGG 2 cut(s) 757, 783
AflII CTTAAG 1 cut(s) 912
AgsI TTSAA 2 cut(s) 640, 765
AhlI ACTAGT 1 cut(s) 303
AjnI CCWGG 1 cut(s) 67
AluBI AGCT 6 cut(s) 35, 163, 402, 414, 591, 697
AluI AGCT 6 cut(s) 35, 163, 402, 414, 591, 697
Alw26I GTCTC 1 cut(s) 117
AlwI GGATC 1 cut(s) 583
AlwNI CAGNNNCTG 2 cut(s) 93, 414
AoxI GGCC 3 cut(s) 466, 530, 798
ApeKI GCWGC 8 cut(s) 402, 408, 411, 414, 444, 456, 705, 894
ApoI RAATTY 3 cut(s) 501, 674, 719
AspLEI GCGC 2 cut(s) 232, 274
AspS9I GGNCC 3 cut(s) 135, 540, 798
AsuHPI GGTGA 2 cut(s) 36, 680
AvaII GGWCC 2 cut(s) 135, 540
BalI TGGCCA 1 cut(s) 468
BbvCI CCTCAGC 1 cut(s) 592
BbvI GCAGC 8 cut(s) 389, 401, 420, 423, 431, 443, 692, 881
BccI CCATC 4 cut(s) 126, 279, 560, 719
BcgI CGANNNNNNTGC 2 cut(s) 873, 907
BciT130I CCWGG 1 cut(s) 69
BcoDI GTCTC 1 cut(s) 117
BcuI ACTAGT 1 cut(s) 303
BfaI CTAG 3 cut(s) 129, 304, 781
BfmI CTRYAG 1 cut(s) 683
BfrI CTTAAG 1 cut(s) 912
Bme1390I CCNGG 1 cut(s) 69
Bme18I GGWCC 2 cut(s) 135, 540
BmgT120I GGNCC 3 cut(s) 135, 540, 798
BmrFI CCNGG 1 cut(s) 69
BmrI ACTGGG 1 cut(s) 617
BmsI GCATC 5 cut(s) 405, 422, 498, 896, 926
BmuI ACTGGG 1 cut(s) 617
BpmI CTGGAG 1 cut(s) 100
Bpu10I CCTNAGC 2 cut(s) 592, 802
BsaJI CCNNGG 1 cut(s) 656
BsaXI ACNNNNNCTCC 4 cut(s) 462, 492, 652, 682
Bsc4I CCNNNNNNNGG 2 cut(s) 757, 783
Bse118I RCCGGY 1 cut(s) 528
Bse1I ACTGG 5 cut(s) 220, 262, 427, 612, 819
Bse3DI GCAATG 1 cut(s) 442
BseBI CCWGG 1 cut(s) 69
BseDI CCNNGG 1 cut(s) 656
BseGI GGATG 1 cut(s) 863
BseLI CCNNNNNNNGG 2 cut(s) 757, 783
BseMI GCAATG 1 cut(s) 442
BseMII CTCAG 2 cut(s) 583, 793
BseNI ACTGG 5 cut(s) 220, 262, 427, 612, 819
BseRI GAGGAG 1 cut(s) 676
BseXI GCAGC 8 cut(s) 389, 401, 420, 423, 431, 443, 692, 881
BsgI GTGCAG 2 cut(s) 430, 691
Bsh1236I CGCG 3 cut(s) 140, 272, 859
BshFI GGCC 3 cut(s) 468, 532, 800
BsiSI CCGG 1 cut(s) 529
BslFI GGGAC 2 cut(s) 93, 385
BslI CCNNNNNNNGG 2 cut(s) 757, 783
BsmAI GTCTC 1 cut(s) 117
BsmFI GGGAC 2 cut(s) 93, 385
BsnI GGCC 3 cut(s) 468, 532, 800
Bsp143I GATC 1 cut(s) 575
Bsp19I CCATGG 1 cut(s) 656
BspACI CCGC 5 cut(s) 138, 325, 406, 441, 612
BspANI GGCC 3 cut(s) 468, 532, 800
BspCNI CTCAG 2 cut(s) 584, 794
BspFNI CGCG 3 cut(s) 140, 272, 859
BspHI TCATGA 1 cut(s) 43
BspPI GGATC 1 cut(s) 583
BspTI CTTAAG 1 cut(s) 912
BsrDI GCAATG 1 cut(s) 442
BsrFI RCCGGY 1 cut(s) 528
BsrI ACTGG 5 cut(s) 220, 262, 427, 612, 819
BssAI RCCGGY 1 cut(s) 528
BssECI CCNNGG 1 cut(s) 656
BssMI GATC 1 cut(s) 575
BssT1I CCWWGG 1 cut(s) 656
Bst2UI CCWGG 1 cut(s) 69
Bst4CI ACNGT 1 cut(s) 836
Bst6I CTCTTC 1 cut(s) 115
BstAFI CTTAAG 1 cut(s) 912
BstAPI GCANNNNNTGC 3 cut(s) 402, 414, 423
BstC8I GCNNGC 2 cut(s) 165, 899
BstDEI CTNAG 2 cut(s) 592, 802
BstDSI CCRYGG 1 cut(s) 656
BstF5I GGATG 1 cut(s) 863
BstFNI CGCG 3 cut(s) 140, 272, 859
BstHHI GCGC 2 cut(s) 232, 274
BstKTI GATC 1 cut(s) 578
BstMAI GTCTC 1 cut(s) 117
BstMBI GATC 1 cut(s) 575
BstNI CCWGG 1 cut(s) 69
BstSCI CCNGG 1 cut(s) 67
BstSFI CTRYAG 1 cut(s) 683
BstUI CGCG 3 cut(s) 140, 272, 859
BstV1I GCAGC 8 cut(s) 389, 401, 420, 423, 431, 443, 692, 881
BsuRI GGCC 3 cut(s) 468, 532, 800
BtgI CCRYGG 1 cut(s) 656
BtgZI GCGATG 1 cut(s) 840
BtsCI GGATG 1 cut(s) 863
BtsIMutI CAGTG 2 cut(s) 434, 605
Cac8I GCNNGC 2 cut(s) 165, 899
CaiI CAGNNNCTG 2 cut(s) 93, 414
CciI TCATGA 1 cut(s) 43
CfoI GCGC 2 cut(s) 232, 274
Cfr10I RCCGGY 1 cut(s) 528
Cfr13I GGNCC 3 cut(s) 135, 540, 798
CseI GACGC 1 cut(s) 795
CsiI ACCWGGT 1 cut(s) 67
Csp6I GTAC 2 cut(s) 142, 822
CviAII CATG 3 cut(s) 44, 572, 657
CviQI GTAC 2 cut(s) 142, 822
DdeI CTNAG 2 cut(s) 592, 802
DpnI GATC 1 cut(s) 577
DpnII GATC 1 cut(s) 575
DraI TTTAAA 1 cut(s) 506
DrdI GACNNNNNNGTC 1 cut(s) 547
DseDI GACNNNNNNGTC 1 cut(s) 547
EaeI YGGCCR 2 cut(s) 466, 530
Eam1104I CTCTTC 1 cut(s) 115
EarI CTCTTC 1 cut(s) 115
EciI GGCGGA 1 cut(s) 627
Eco130I CCWWGG 1 cut(s) 656
Eco47I GGWCC 2 cut(s) 135, 540
EcoO109I RGGNCCY 1 cut(s) 798
EcoRII CCWGG 1 cut(s) 67
EcoT14I CCWWGG 1 cut(s) 656
ErhI CCWWGG 1 cut(s) 656
FaeI CATG 3 cut(s) 47, 575, 660
FaiI YATR 8 cut(s) 45, 568, 573, 586, 632, 658, 685, 729
FalI AAGNNNNNCTT 2 cut(s) 200, 232
FaqI GGGAC 2 cut(s) 93, 385
FatI CATG 3 cut(s) 43, 571, 656
FokI GGATG 1 cut(s) 850
FspBI CTAG 3 cut(s) 129, 304, 781
FspI TGCGCA 1 cut(s) 231
GlaI GCGC 2 cut(s) 231, 273
GsuI CTGGAG 1 cut(s) 100
HaeIII GGCC 3 cut(s) 468, 532, 800
HapII CCGG 1 cut(s) 529
HgaI GACGC 1 cut(s) 795
HhaI GCGC 2 cut(s) 232, 274
Hin1II CATG 3 cut(s) 47, 575, 660
Hin6I GCGC 2 cut(s) 230, 272
HinP1I GCGC 2 cut(s) 230, 272
HincII GTYRAC 1 cut(s) 653
HindII GTYRAC 1 cut(s) 653
HinfI GANTC 8 cut(s) 90, 125, 189, 390, 477, 561, 741, 846
HpaI GTTAAC 1 cut(s) 653
HpaII CCGG 1 cut(s) 529
HphI GGTGA 2 cut(s) 36, 680
Hpy166II GTNNAC 2 cut(s) 249, 653
Hpy188I TCNGA 4 cut(s) 95, 203, 716, 746
Hpy188III TCNNGA 4 cut(s) 44, 117, 129, 558
Hpy8I GTNNAC 2 cut(s) 249, 653
HpyAV CCTTC 4 cut(s) 41, 53, 750, 835
HpyCH4III ACNGT 1 cut(s) 836
HpyCH4IV ACGT 1 cut(s) 649
HpyCH4V TGCA 7 cut(s) 380, 387, 417, 435, 447, 459, 708
HpyF3I CTNAG 2 cut(s) 592, 802
HpySE526I ACGT 1 cut(s) 649
Hsp92II CATG 3 cut(s) 47, 575, 660
HspAI GCGC 2 cut(s) 230, 272
KspAI GTTAAC 1 cut(s) 653
Kzo9I GATC 1 cut(s) 575
Lsp1109I GCAGC 8 cut(s) 389, 401, 420, 423, 431, 443, 692, 881
LweI GCATC 5 cut(s) 405, 422, 498, 896, 926
MabI ACCWGGT 1 cut(s) 67
MaeI CTAG 3 cut(s) 129, 304, 781
MaeII ACGT 1 cut(s) 649
MaeIII GTNAC 1 cut(s) 170
MalI GATC 1 cut(s) 577
MboI GATC 1 cut(s) 575
MboII GAAGA 5 cut(s) 132, 208, 628, 683, 700
MlsI TGGCCA 1 cut(s) 468
MluCI AATT 8 cut(s) 180, 381, 501, 521, 674, 719, 788, 870
MluNI TGGCCA 1 cut(s) 468
MlyI GAGTC 6 cut(s) 119, 198, 384, 471, 555, 840
MnlI CCTC 7 cut(s) 124, 247, 587, 654, 659, 787, 820
Mox20I TGGCCA 1 cut(s) 468
MscI TGGCCA 1 cut(s) 468
MseI TTAA 3 cut(s) 505, 652, 913
MslI CAYNNNNRTG 1 cut(s) 583
Msp20I TGGCCA 1 cut(s) 468
MspA1I CMGCKG 2 cut(s) 402, 414
MspCI CTTAAG 1 cut(s) 912
MspI CCGG 1 cut(s) 529
MspR9I CCNGG 1 cut(s) 69
MvaI CCWGG 1 cut(s) 69
MvnI CGCG 3 cut(s) 140, 272, 859
NcoI CCATGG 1 cut(s) 656
NdeII GATC 1 cut(s) 575
NlaIII CATG 3 cut(s) 47, 575, 660
NmeAIII GCCGAG 1 cut(s) 372
NmuCI GTSAC 1 cut(s) 170
NsbI TGCGCA 1 cut(s) 231
PagI TCATGA 1 cut(s) 43
PfeI GAWTC 2 cut(s) 90, 741
PleI GAGTC 6 cut(s) 119, 197, 384, 471, 555, 840
PpsI GAGTC 6 cut(s) 119, 197, 384, 471, 555, 840
Psp6I CCWGG 1 cut(s) 67
PspGI CCWGG 1 cut(s) 67
PspPI GGNCC 3 cut(s) 135, 540, 798
PstNI CAGNNNCTG 2 cut(s) 93, 414
PvuII CAGCTG 2 cut(s) 402, 414
RsaI GTAC 2 cut(s) 143, 823
RsaNI GTAC 2 cut(s) 142, 822
RseI CAYNNNNRTG 1 cut(s) 583
SaqAI TTAA 3 cut(s) 505, 652, 913
Sau3AI GATC 1 cut(s) 575
Sau96I GGNCC 3 cut(s) 135, 540, 798
SchI GAGTC 6 cut(s) 119, 198, 384, 471, 555, 840
ScrFI CCNGG 1 cut(s) 69
SexAI ACCWGGT 1 cut(s) 67
SfaNI GCATC 5 cut(s) 405, 422, 498, 896, 926
SfcI CTRYAG 1 cut(s) 683
SinI GGWCC 2 cut(s) 135, 540
SmiMI CAYNNNNRTG 1 cut(s) 583
SmlI CTYRAG 1 cut(s) 912
SmoI CTYRAG 1 cut(s) 912
SpeI ACTAGT 1 cut(s) 303
Sse9I AATT 8 cut(s) 180, 381, 501, 521, 674, 719, 788, 870
SsiI CCGC 5 cut(s) 138, 325, 406, 441, 612
SspMI CTAG 3 cut(s) 129, 304, 781
StyD4I CCNGG 1 cut(s) 67
StyI CCWWGG 1 cut(s) 656
TaaI ACNGT 1 cut(s) 836
TaiI ACGT 1 cut(s) 652
TaqI TCGA 1 cut(s) 516
TasI AATT 8 cut(s) 180, 381, 501, 521, 674, 719, 788, 870
TauI GCSGC 2 cut(s) 408, 444
TfiI GAWTC 2 cut(s) 90, 741
Tru1I TTAA 3 cut(s) 505, 652, 913
Tru9I TTAA 3 cut(s) 505, 652, 913
TscAI CASTG 2 cut(s) 434, 612
TseFI GTSAC 1 cut(s) 170
TseI GCWGC 8 cut(s) 402, 408, 411, 414, 444, 456, 705, 894
Tsp45I GTSAC 1 cut(s) 170
TspDTI ATGAA 8 cut(s) 60, 514, 601, 744, 754, 769, 843, 852
TspRI CASTG 2 cut(s) 434, 612
Vha464I CTTAAG 1 cut(s) 912
VpaK11BI GGWCC 2 cut(s) 135, 540
XapI RAATTY 3 cut(s) 501, 674, 719
XbaI TCTAGA 1 cut(s) 128
XcmI CCANNNNNNNNNTGG 1 cut(s) 434
XspI CTAG 3 cut(s) 129, 304, 781
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.