pycom03g12380

This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the transport of calcium

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
Physical Location & Seq
Forward (+)
12845132 .. 12845395
264 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g12380.1

Sequence Viewer

Length: 264 bp
ATGTCTGGAGTTAATAAATTCACTGAAAAACCATTCCGTGGATTTATTGTTTATGTATGGGAAGCCCTTCAAGACACTACCCTTATGATACTTGCTTTTTGTGCCTTTGGATCTCCACTTGAAAGAAATCGTATGGGAAAATCTTTTCTTAGGCCCTTGGCTAATTCTCAAGACATTGATATTGTATCTATCAAGAAAATAAAAGTAGCCTCCCTGTTGAGTTCGATAGTTTCTTTACGATCGATATGTGAAGGCATATTTTAA

Protein Analysis

88

Amino Acids

9.75

Weight (kDa)

9.44

Isoelectric Point (pI)

41.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 38
AclWI GGATC 1 cut(s) 118
AcsI RAATTY 1 cut(s) 17
AfiI CCNNNNNNNGG 1 cut(s) 38
AgsI TTSAA 2 cut(s) 71, 122
AlwI GGATC 1 cut(s) 118
AoxI GGCC 1 cut(s) 152
ApoI RAATTY 1 cut(s) 17
Asp700I GAANNNNTTC 1 cut(s) 66
AspS9I GGNCC 1 cut(s) 153
BmgT120I GGNCC 1 cut(s) 153
BpmI CTGGAG 1 cut(s) 27
BpuEI CTTGAG 1 cut(s) 153
Bsa29I ATCGAT 1 cut(s) 242
BsaJI CCNNGG 2 cut(s) 37, 156
Bsc4I CCNNNNNNNGG 1 cut(s) 38
BseCI ATCGAT 1 cut(s) 242
BseDI CCNNGG 2 cut(s) 37, 156
BseLI CCNNNNNNNGG 1 cut(s) 38
Bsh1285I CGRYCG 1 cut(s) 242
BshFI GGCC 1 cut(s) 154
BshVI ATCGAT 1 cut(s) 242
BsiEI CGRYCG 1 cut(s) 242
BslI CCNNNNNNNGG 1 cut(s) 38
BsnI GGCC 1 cut(s) 154
Bsp143I GATC 2 cut(s) 110, 239
BspANI GGCC 1 cut(s) 154
BspDI ATCGAT 1 cut(s) 242
BspPI GGATC 1 cut(s) 118
BssECI CCNNGG 2 cut(s) 37, 156
BssMI GATC 2 cut(s) 110, 239
BssT1I CCWWGG 1 cut(s) 156
BstDEI CTNAG 1 cut(s) 149
BstDSI CCRYGG 1 cut(s) 37
BstKTI GATC 2 cut(s) 113, 242
BstMBI GATC 2 cut(s) 110, 239
BstMCI CGRYCG 1 cut(s) 242
BstMWI GCNNNNNNNGC 1 cut(s) 101
BstX2I RGATCY 1 cut(s) 110
BstYI RGATCY 1 cut(s) 110
Bsu15I ATCGAT 1 cut(s) 242
BsuRI GGCC 1 cut(s) 154
BsuTUI ATCGAT 1 cut(s) 242
BtgI CCRYGG 1 cut(s) 37
BtsIMutI CAGTG 1 cut(s) 21
Cfr13I GGNCC 1 cut(s) 153
ClaI ATCGAT 1 cut(s) 242
CviJI RGCY 4 cut(s) 65, 154, 161, 209
CviKI_1 RGCY 4 cut(s) 65, 154, 161, 209
DdeI CTNAG 1 cut(s) 149
DpnI GATC 2 cut(s) 112, 241
DpnII GATC 2 cut(s) 110, 239
Eco130I CCWWGG 1 cut(s) 156
EcoO109I RGGNCCY 1 cut(s) 153
EcoT14I CCWWGG 1 cut(s) 156
ErhI CCWWGG 1 cut(s) 156
FaiI YATR 6 cut(s) 54, 58, 86, 134, 247, 257
GsuI CTGGAG 1 cut(s) 27
HaeIII GGCC 1 cut(s) 154
Hpy188III TCNNGA 4 cut(s) 6, 71, 170, 193
HpyAV CCTTC 2 cut(s) 77, 245
HpyF10VI GCNNNNNNNGC 1 cut(s) 101
HpyF3I CTNAG 1 cut(s) 149
Kzo9I GATC 2 cut(s) 110, 239
LpnPI CCDG 1 cut(s) 227
MalI GATC 2 cut(s) 112, 241
MboI GATC 2 cut(s) 110, 239
MflI RGATCY 1 cut(s) 110
MluCI AATT 2 cut(s) 17, 163
MnlI CCTC 1 cut(s) 220
MroXI GAANNNNTTC 1 cut(s) 66
MseI TTAA 2 cut(s) 12, 262
MwoI GCNNNNNNNGC 1 cut(s) 101
NdeII GATC 2 cut(s) 110, 239
PdmI GAANNNNTTC 1 cut(s) 66
PflMI CCANNNNNTGG 1 cut(s) 38
Ple19I CGATCG 1 cut(s) 242
PspPI GGNCC 1 cut(s) 153
PsuI RGATCY 1 cut(s) 110
PvuI CGATCG 1 cut(s) 242
SaqAI TTAA 2 cut(s) 12, 262
Sau3AI GATC 2 cut(s) 110, 239
Sau96I GGNCC 1 cut(s) 153
SgeI CNNG 9 cut(s) 18, 50, 83, 104, 131, 169, 182, 205, 226
SmlI CTYRAG 1 cut(s) 168
SmoI CTYRAG 1 cut(s) 168
Sse9I AATT 2 cut(s) 17, 163
StyI CCWWGG 1 cut(s) 156
TaqI TCGA 2 cut(s) 224, 242
TasI AATT 2 cut(s) 17, 163
Tru1I TTAA 2 cut(s) 12, 262
Tru9I TTAA 2 cut(s) 12, 262
TscAI CASTG 1 cut(s) 28
TspGWI ACGGA 1 cut(s) 26
TspRI CASTG 1 cut(s) 28
Van91I CCANNNNNTGG 1 cut(s) 38
XapI RAATTY 1 cut(s) 17
XmnI GAANNNNTTC 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.