Rmu_co8027370.1_g000001

IST1 homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8027370.1
Physical Location & Seq
Reverse (-)
1 .. 498
498 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8027370.1_g000001.1.cds

Sequence Viewer

Length: 293 bp
atgaagcgtggcctctctcgtttgctttccggattcgactcttgcaaatgtaaagttgcattaaatatggtattggctagaataaaggttgtgttgaacgagagaatgacagaggtgaagcagatgaggcatgacatcgcttcactccttcagaaaggtcaagaagtcactgctcgtatcttgtatcgtttaaatatcgtgttactcaaggcttgtattccttcttcatataggacttatggaacatgtgactctgctatctttgttcttttggttaaagaaatagttttatg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

10.99

Weight (kDa)

9.83

Isoelectric Point (pI)

39.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 29
AcuI CTGAAG 1 cut(s) 134
AflIII ACRYGT 1 cut(s) 245
AgsI TTSAA 1 cut(s) 97
Aor13HI TCCGGA 1 cut(s) 29
AoxI GGCC 1 cut(s) 10
AsuHPI GGTGA 1 cut(s) 127
BarI GAAGNNNNNNTAC 2 cut(s) 208, 240
BfaI CTAG 1 cut(s) 78
BpuEI CTTGAG 1 cut(s) 191
BsaWI WCCGGW 1 cut(s) 29
BseAI TCCGGA 1 cut(s) 29
BshFI GGCC 1 cut(s) 12
BsiSI CCGG 1 cut(s) 30
BsnI GGCC 1 cut(s) 12
Bsp13I TCCGGA 1 cut(s) 29
BspANI GGCC 1 cut(s) 12
BspEI TCCGGA 1 cut(s) 29
BstMWI GCNNNNNNNGC 1 cut(s) 127
BstNSI RCATGY 1 cut(s) 249
BsuRI GGCC 1 cut(s) 12
BtgZI GCGATG 1 cut(s) 121
BtsI GCAGTG 1 cut(s) 168
BtsIMutI CAGTG 1 cut(s) 168
CviAII CATG 2 cut(s) 131, 246
CviJI RGCY 3 cut(s) 12, 77, 212
CviKI_1 RGCY 3 cut(s) 12, 77, 212
DraI TTTAAA 1 cut(s) 192
Eco57I CTGAAG 1 cut(s) 134
FaeI CATG 2 cut(s) 134, 249
FaiI YATR 7 cut(s) 68, 132, 229, 231, 240, 247, 292
FatI CATG 2 cut(s) 130, 245
FspBI CTAG 1 cut(s) 78
HaeIII GGCC 1 cut(s) 12
HapII CCGG 1 cut(s) 30
Hin1II CATG 2 cut(s) 134, 249
HinfI GANTC 3 cut(s) 33, 38, 251
HpaII CCGG 1 cut(s) 30
HphI GGTGA 1 cut(s) 127
Hpy188I TCNGA 1 cut(s) 153
Hpy188III TCNNGA 2 cut(s) 30, 161
HpyAV CCTTC 2 cut(s) 158, 231
HpyCH4V TGCA 2 cut(s) 45, 59
HpyF10VI GCNNNNNNNGC 1 cut(s) 127
Hsp92II CATG 2 cut(s) 134, 249
Kpn2I TCCGGA 1 cut(s) 29
LpnPI CCDG 1 cut(s) 43
MaeI CTAG 1 cut(s) 78
MaeIII GTNAC 3 cut(s) 166, 201, 248
MboII GAAGA 1 cut(s) 216
MlyI GAGTC 2 cut(s) 32, 245
MnlI CCTC 3 cut(s) 23, 106, 120
MroI TCCGGA 1 cut(s) 29
MseI TTAA 3 cut(s) 62, 191, 276
MspI CCGG 1 cut(s) 30
MwoI GCNNNNNNNGC 1 cut(s) 127
NlaIII CATG 2 cut(s) 134, 249
NmuCI GTSAC 2 cut(s) 166, 248
NspI RCATGY 1 cut(s) 249
PciI ACATGT 1 cut(s) 245
PfeI GAWTC 1 cut(s) 33
PleI GAGTC 2 cut(s) 32, 245
PpsI GAGTC 2 cut(s) 32, 245
PscI ACATGT 1 cut(s) 245
SaqAI TTAA 3 cut(s) 62, 191, 276
SchI GAGTC 2 cut(s) 32, 245
SetI ASST 3 cut(s) 90, 117, 160
SmlI CTYRAG 1 cut(s) 206
SmoI CTYRAG 1 cut(s) 206
SspMI CTAG 1 cut(s) 78
TaqI TCGA 1 cut(s) 36
TfiI GAWTC 1 cut(s) 33
Tru1I TTAA 3 cut(s) 62, 191, 276
Tru9I TTAA 3 cut(s) 62, 191, 276
TscAI CASTG 1 cut(s) 175
TseFI GTSAC 2 cut(s) 166, 248
Tsp45I GTSAC 2 cut(s) 166, 248
TspDTI ATGAA 2 cut(s) 17, 216
TspRI CASTG 1 cut(s) 175
XceI RCATGY 1 cut(s) 249
XspI CTAG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.