Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr07

Orthogroup ID

OG0002510

Physical Location & Seq

Genomic Coordinates Reverse (-)

11697812 .. 11703028

Gene Structure 5217 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD07G1103300.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 156 bp

ATGTTTTTGCTTTCCCCAATGCCAAAATATTTTCCCCCAATTCGAAGAAGAGGAAGATTGTTGACATCATTTTATTCCTTGAAAAAGTTGCATGCTAAGAAGAGGAAGATTGTTGACAGAAGAGCCTCTAATAGTCGCAAGATAAGGTATCAATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005730 GO:0006355 GO:0006357 GO:0008150 GO:0009889 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0031323 GO:0031326 GO:0031974 GO:0031981 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0070013 GO:0080090 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AATF-Che1 TRAUB

Protein Analysis

52

Amino Acids

6.25

Weight (kDa)

11.93

Isoelectric Point (pI)

67.47

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002510)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G61330 AT5G61330 AT5G61330
fragaria_vesca	FvH4_7g09370 FvH4_7g09810 FvH4_7g09810 FvH4_7g09810 FvH4_7g09810 FvH4_7g09810 FvH4_7g09810
malus_domestica	MD02G1217000.v1.1 MD02G1263900.v1.1 MD02G1264000.v1.1 MD07G1073400.v1.1 MD07G1101900.v1.1 MD07G1102000.v1.1 MD07G1102300.v1.1 MD07G1103300.v1.1 MD08G1040900.v1.1
prunus_persica	Prupe.2G127200_v2.0.a1 Prupe.2G127200_v2.0.a1 Prupe.2G127200_v2.0.a1 Prupe.2G127200_v2.0.a1
pyrus_communis	pycom02g17860 pycom07g05740 pycom07g05770 pycom07g08340
rosa_chinensis	RchiOBHm_Chr1g0346971
rosa_laevigata	RLG00000028767
rosa_multiflora	Rmu_co8367419.1_g000001 Rmu_sc0001731.1_g000013 Rmu_sc0002705.1_g000017 Rmu_sc0008581.1_g000020
rosa_roxburghii	Rroxscaffold_4G00308010
rosa_samantha	Rh1AG202700 Rh1BG168600 Rh1BG168700 Rh1CG187400 Rh1DG199300 Rh1DG199400
rosa_wichuraiana	Rw1G016980

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	82
AsuII	TTCGAA	1 cut(s)	43
Bpu14I	TTCGAA	1 cut(s)	43
Bsp119I	TTCGAA	1 cut(s)	43
BspQI	GCTCTTC	1 cut(s)	115
BspT104I	TTCGAA	1 cut(s)	43
Bst6I	CTCTTC	3 cut(s)	43, 95, 115
BstBI	TTCGAA	1 cut(s)	43
BstC8I	GCNNGC	1 cut(s)	93
BstDEI	CTNAG	1 cut(s)	96
BstNSI	RCATGY	1 cut(s)	95
Cac8I	GCNNGC	1 cut(s)	93
CviAII	CATG	1 cut(s)	92
CviJI	RGCY	1 cut(s)	125
CviKI_1	RGCY	1 cut(s)	125
DdeI	CTNAG	1 cut(s)	96
Eam1104I	CTCTTC	3 cut(s)	43, 95, 115
EarI	CTCTTC	3 cut(s)	43, 95, 115
FaeI	CATG	1 cut(s)	95
FaiI	YATR	1 cut(s)	93
FatI	CATG	1 cut(s)	91
Hin1II	CATG	1 cut(s)	95
HincII	GTYRAC	2 cut(s)	63, 115
HindII	GTYRAC	2 cut(s)	63, 115
Hpy166II	GTNNAC	2 cut(s)	63, 115
Hpy8I	GTNNAC	2 cut(s)	63, 115
HpyCH4V	TGCA	1 cut(s)	91
HpyF3I	CTNAG	1 cut(s)	96
Hsp92II	CATG	1 cut(s)	95
LguI	GCTCTTC	1 cut(s)	115
MboII	GAAGA	6 cut(s)	57, 60, 66, 112, 118, 132
MluCI	AATT	1 cut(s)	39
MnlI	CCTC	3 cut(s)	44, 96, 136
NlaIII	CATG	1 cut(s)	95
NspI	RCATGY	1 cut(s)	95
NspV	TTCGAA	1 cut(s)	43
PaeI	GCATGC	1 cut(s)	95
PciSI	GCTCTTC	1 cut(s)	115
SapI	GCTCTTC	1 cut(s)	115
SetI	ASST	1 cut(s)	149
SfuI	TTCGAA	1 cut(s)	43
SgeI	CNNG	3 cut(s)	91, 104, 151
SphI	GCATGC	1 cut(s)	95
Sse9I	AATT	1 cut(s)	39
SspI	AATATT	1 cut(s)	29
TaqI	TCGA	1 cut(s)	43
TasI	AATT	1 cut(s)	39
XceI	RCATGY	1 cut(s)	95

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.