MD07G1187300.v1.1

3-ketoacyl-CoA synthase

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Forward (+)
26816911 .. 26817069
159 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1187300.v1.1.491

Sequence Viewer

Length: 159 bp
ATGAAGGACTTGGATGATGTCAATGTGTGGAAAGACTGCATAGATAGTTACCCTAGGGATCAAAACCAAGTCAATCCGTTCATTGAAAAGTATGGCTGGATCAATGATGATTATCTAAGCTTTGTTAGGTTTGACATGTCCCTATTCGCTATTGAGTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

53

Amino Acids

6.31

Weight (kDa)

4.17

Isoelectric Point (pI)

43.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 66, 107
AflIII ACRYGT 1 cut(s) 135
AgsI TTSAA 1 cut(s) 86
AluBI AGCT 1 cut(s) 120
AluI AGCT 1 cut(s) 120
AlwI GGATC 2 cut(s) 66, 107
AspA2I CCTAGG 1 cut(s) 53
AvrII CCTAGG 1 cut(s) 53
BfaI CTAG 1 cut(s) 54
BlnI CCTAGG 1 cut(s) 53
BsaBI GATNNNNATC 1 cut(s) 111
BsaJI CCNNGG 1 cut(s) 53
Bse8I GATNNNNATC 1 cut(s) 111
BseDI CCNNGG 1 cut(s) 53
BseGI GGATG 1 cut(s) 19
BseJI GATNNNNATC 1 cut(s) 111
BslFI GGGAC 1 cut(s) 124
BsmFI GGGAC 1 cut(s) 124
Bsp143I GATC 2 cut(s) 58, 99
BspPI GGATC 2 cut(s) 66, 107
BssECI CCNNGG 1 cut(s) 53
BssMI GATC 2 cut(s) 58, 99
BssT1I CCWWGG 1 cut(s) 53
BstDEI CTNAG 1 cut(s) 116
BstF5I GGATG 1 cut(s) 19
BstKTI GATC 2 cut(s) 61, 102
BstMBI GATC 2 cut(s) 58, 99
BstNSI RCATGY 1 cut(s) 139
BtsCI GGATG 1 cut(s) 19
CviAII CATG 1 cut(s) 136
CviJI RGCY 2 cut(s) 96, 120
CviKI_1 RGCY 2 cut(s) 96, 120
DdeI CTNAG 1 cut(s) 116
DpnI GATC 2 cut(s) 60, 101
DpnII GATC 2 cut(s) 58, 99
Eco130I CCWWGG 1 cut(s) 53
EcoT14I CCWWGG 1 cut(s) 53
ErhI CCWWGG 1 cut(s) 53
FaeI CATG 1 cut(s) 139
FaiI YATR 3 cut(s) 41, 93, 137
FaqI GGGAC 1 cut(s) 124
FatI CATG 1 cut(s) 135
FokI GGATG 1 cut(s) 26
FspBI CTAG 1 cut(s) 54
Hin1II CATG 1 cut(s) 139
HindIII AAGCTT 1 cut(s) 118
HpyCH4V TGCA 1 cut(s) 39
HpyF3I CTNAG 1 cut(s) 116
Hsp92II CATG 1 cut(s) 139
Kzo9I GATC 2 cut(s) 58, 99
LpnPI CCDG 1 cut(s) 82
MaeI CTAG 1 cut(s) 54
MaeIII GTNAC 1 cut(s) 47
MalI GATC 2 cut(s) 60, 101
MboI GATC 2 cut(s) 58, 99
NdeII GATC 2 cut(s) 58, 99
NlaIII CATG 1 cut(s) 139
NspI RCATGY 1 cut(s) 139
PciI ACATGT 1 cut(s) 135
PscI ACATGT 1 cut(s) 135
Sau3AI GATC 2 cut(s) 58, 99
SetI ASST 2 cut(s) 122, 131
SgeI CNNG 5 cut(s) 22, 66, 80, 109, 148
SspMI CTAG 1 cut(s) 54
StyI CCWWGG 1 cut(s) 53
TspDTI ATGAA 2 cut(s) 17, 70
TspGWI ACGGA 1 cut(s) 66
XceI RCATGY 1 cut(s) 139
XmaJI CCTAGG 1 cut(s) 53
XspI CTAG 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.