Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr15

Orthogroup ID

OG0004989

Physical Location & Seq

Genomic Coordinates Forward (+)

50249964 .. 50251479

Gene Structure 1516 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD15G1401700.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 189 bp

ATGGGTGAAAGGCAACATCTGCCCTTACTCCTTAGAGATGCTTTGGATGATAAAGGTTGGAGCTATCAAATTGATGAAGGTGGTGGTGCCTTTTATGGTCCAAAGATTGATCTTAAGATTGAGGATGCCCTTGGAAGGAGGTGGCAGTGCTCAACTATACAAGTTAATCCTGAACTCATGACGGGATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0003674 GO:0003824 GO:0004812 GO:0004829 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0006082 GO:0006139 GO:0006399 GO:0006412 GO:0006418 GO:0006435 GO:0006518 GO:0006520 GO:0006725 GO:0006807 GO:0007275 GO:0008150 GO:0008152 GO:0009058 GO:0009059 GO:0009507 GO:0009532 GO:0009536 GO:0009570 GO:0009790 GO:0009791 GO:0009793 GO:0009987 GO:0010154 GO:0010467 GO:0016070 GO:0016874 GO:0016875 GO:0019538 GO:0019752 GO:0022414 GO:0032501 GO:0032502 GO:0034641 GO:0034645 GO:0034660 GO:0043038 GO:0043039 GO:0043043 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043436 GO:0043603 GO:0043604 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044267 GO:0044271 GO:0044281 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0046483 GO:0048316 GO:0048608 GO:0048731 GO:0048856 GO:0061458 GO:0071704 GO:0090304 GO:0140098 GO:0140101 GO:1901360 GO:1901564 GO:1901566 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko00970 map00970

Pfam Domains

Protein Families

HGTP_anticodon tRNA-synt_2b tRNA_SAD

Protein Analysis

63

Amino Acids

7.0

Weight (kDa)

4.83

Isoelectric Point (pI)

46.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004989)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G17960 AT1G17960
malus_domestica	MD15G1401700.v1.1 MD15G1402000.v1.1
rosa_chinensis	RchiOBHm_Chr4g0444231
rosa_laevigata	RLG00000005339 RLG00000005847 RLG00000008520 RLG00000020302
rosa_multiflora	Rmu_sc0000016.1_g000006 Rmu_sc0000987.1_g000022 Rmu_sc0014698.1_g000003
rosa_roxburghii	Rroxscaffold_3G00219500 Rroxscaffold_5G00384800
rosa_rugosa	Rorug03G0334500 Rorug07G0196800
rosa_samantha	Rh1BG152700 Rh1CG027000 Rh1DG185100 Rh2BG464200 Rh4AG158400 Rh4BG163900 Rh4CG184100 Rh4DG152900 Rh4DG153000 Rh5CG279500 Rh6BG190300 Rh7CG027100 Rh7DG026600 Rh7DG335900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	86
AfiI	CCNNNNNNNGG	1 cut(s)	135
AflII	CTTAAG	1 cut(s)	113
AluBI	AGCT	1 cut(s)	63
AluI	AGCT	1 cut(s)	63
Alw21I	GWGCWC	1 cut(s)	152
AspS9I	GGNCC	1 cut(s)	98
AsuHPI	GGTGA	1 cut(s)	17
AvaII	GGWCC	1 cut(s)	98
BanI	GGYRCC	1 cut(s)	86
Bbv12I	GWGCWC	1 cut(s)	152
BfrI	CTTAAG	1 cut(s)	113
Bme18I	GGWCC	1 cut(s)	98
BmgT120I	GGNCC	1 cut(s)	98
BmiI	GGNNCC	1 cut(s)	88
BmsI	GCATC	2 cut(s)	28, 115
BsaJI	CCNNGG	1 cut(s)	130
Bsc4I	CCNNNNNNNGG	1 cut(s)	135
BseDI	CCNNGG	1 cut(s)	130
BseGI	GGATG	2 cut(s)	52, 130
BseLI	CCNNNNNNNGG	1 cut(s)	135
BshNI	GGYRCC	1 cut(s)	86
BsiHKAI	GWGCWC	1 cut(s)	152
BslI	CCNNNNNNNGG	1 cut(s)	135
Bsp1286I	GDGCHC	1 cut(s)	152
Bsp143I	GATC	1 cut(s)	109
BspHI	TCATGA	1 cut(s)	177
BspLI	GGNNCC	1 cut(s)	88
BspT107I	GGYRCC	1 cut(s)	86
BspTI	CTTAAG	1 cut(s)	113
BssECI	CCNNGG	1 cut(s)	130
BssMI	GATC	1 cut(s)	109
BssT1I	CCWWGG	1 cut(s)	130
BstAFI	CTTAAG	1 cut(s)	113
BstAPI	GCANNNNNTGC	1 cut(s)	19
BstDEI	CTNAG	1 cut(s)	32
BstF5I	GGATG	2 cut(s)	52, 130
BstKTI	GATC	1 cut(s)	112
BstMBI	GATC	1 cut(s)	109
BstMWI	GCNNNNNNNGC	1 cut(s)	19
BtsCI	GGATG	2 cut(s)	52, 130
BtsI	GCAGTG	1 cut(s)	152
BtsIMutI	CAGTG	1 cut(s)	152
CciI	TCATGA	1 cut(s)	177
Cfr13I	GGNCC	1 cut(s)	98
CviAII	CATG	1 cut(s)	178
CviJI	RGCY	1 cut(s)	63
CviKI_1	RGCY	1 cut(s)	63
DdeI	CTNAG	1 cut(s)	32
DpnI	GATC	1 cut(s)	111
DpnII	GATC	1 cut(s)	109
Eco130I	CCWWGG	1 cut(s)	130
Eco47I	GGWCC	1 cut(s)	98
EcoT14I	CCWWGG	1 cut(s)	130
ErhI	CCWWGG	1 cut(s)	130
FaeI	CATG	1 cut(s)	181
FaiI	YATR	3 cut(s)	96, 158, 179
FatI	CATG	1 cut(s)	177
FokI	GGATG	2 cut(s)	59, 137
Hin1II	CATG	1 cut(s)	181
HphI	GGTGA	1 cut(s)	17
Hpy188III	TCNNGA	2 cut(s)	170, 178
HpyAV	CCTTC	2 cut(s)	71, 129
HpyF10VI	GCNNNNNNNGC	1 cut(s)	19
HpyF3I	CTNAG	1 cut(s)	32
Hsp92II	CATG	1 cut(s)	181
Kzo9I	GATC	1 cut(s)	109
LmnI	GCTCC	1 cut(s)	60
LpnPI	CCDG	1 cut(s)	183
LweI	GCATC	2 cut(s)	28, 115
MalI	GATC	1 cut(s)	111
MboI	GATC	1 cut(s)	109
MhlI	GDGCHC	1 cut(s)	152
MluCI	AATT	1 cut(s)	69
MmeI	TCCRAC	1 cut(s)	38
MnlI	CCTC	2 cut(s)	115, 132
MseI	TTAA	2 cut(s)	114, 165
MspCI	CTTAAG	1 cut(s)	113
MwoI	GCNNNNNNNGC	1 cut(s)	19
NdeII	GATC	1 cut(s)	109
NlaIII	CATG	1 cut(s)	181
NlaIV	GGNNCC	1 cut(s)	88
PagI	TCATGA	1 cut(s)	177
PspN4I	GGNNCC	1 cut(s)	88
PspPI	GGNCC	1 cut(s)	98
SaqAI	TTAA	2 cut(s)	114, 165
Sau3AI	GATC	1 cut(s)	109
Sau96I	GGNCC	1 cut(s)	98
SduI	GDGCHC	1 cut(s)	152
SetI	ASST	4 cut(s)	58, 65, 82, 143
SfaNI	GCATC	2 cut(s)	28, 115
SgeI	CNNG	3 cut(s)	143, 173, 182
SinI	GGWCC	1 cut(s)	98
SmlI	CTYRAG	1 cut(s)	113
SmoI	CTYRAG	1 cut(s)	113
Sse9I	AATT	1 cut(s)	69
StyI	CCWWGG	1 cut(s)	130
TasI	AATT	1 cut(s)	69
Tru1I	TTAA	2 cut(s)	114, 165
Tru9I	TTAA	2 cut(s)	114, 165
TscAI	CASTG	1 cut(s)	152
TspDTI	ATGAA	1 cut(s)	90
TspRI	CASTG	1 cut(s)	152
Vha464I	CTTAAG	1 cut(s)	113
VpaK11BI	GGWCC	1 cut(s)	98

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.