Rh4DG153000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
30427198 .. 30427809
612 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG153000.1

Sequence Viewer

Length: 189 bp
ATGGGTCCTGCCCCATCTCCTCCACCCATCATCATCGATTCCACCACCGCCCAGATGAAATCCGAGAGCTTCGGGGCCCAGACACAGTTTTCCAGTTGTCGCCCAAGCATTCAAGAAGTGAATTGTATGTTCAGGTTATTTGAGCTGTCGATTGGCTATGACTTTGACTATGATGAATACCACAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.04

Weight (kDa)

4.5

Isoelectric Point (pI)

69.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 48
AgsI TTSAA 1 cut(s) 113
AluBI AGCT 2 cut(s) 69, 145
AluI AGCT 2 cut(s) 69, 145
AoxI GGCC 1 cut(s) 75
ApaI GGGCCC 1 cut(s) 79
AspS9I GGNCC 3 cut(s) 5, 75, 76
AvaII GGWCC 1 cut(s) 5
BaeGI GKGCMC 1 cut(s) 79
BanII GRGCYC 1 cut(s) 79
BccI CCATC 2 cut(s) 22, 35
Bme18I GGWCC 1 cut(s) 5
BmgT120I GGNCC 3 cut(s) 5, 75, 76
BmiI GGNNCC 3 cut(s) 6, 76, 77
Bsa29I ATCGAT 1 cut(s) 36
Bse1I ACTGG 1 cut(s) 93
BseCI ATCGAT 1 cut(s) 36
BseNI ACTGG 1 cut(s) 93
BseRI GAGGAG 1 cut(s) 9
BseSI GKGCMC 1 cut(s) 79
BshFI GGCC 1 cut(s) 77
BshVI ATCGAT 1 cut(s) 36
BsmI GAATGC 1 cut(s) 108
BsnI GGCC 1 cut(s) 77
Bsp120I GGGCCC 1 cut(s) 75
Bsp1286I GDGCHC 1 cut(s) 79
BspACI CCGC 1 cut(s) 48
BspANI GGCC 1 cut(s) 77
BspDI ATCGAT 1 cut(s) 36
BspLI GGNNCC 3 cut(s) 6, 76, 77
BsrI ACTGG 1 cut(s) 93
Bst4CI ACNGT 1 cut(s) 87
BstSLI GKGCMC 1 cut(s) 79
Bsu15I ATCGAT 1 cut(s) 36
BsuRI GGCC 1 cut(s) 77
BsuTUI ATCGAT 1 cut(s) 36
Cfr13I GGNCC 3 cut(s) 5, 75, 76
ClaI ATCGAT 1 cut(s) 36
CviJI RGCY 4 cut(s) 69, 77, 145, 156
CviKI_1 RGCY 4 cut(s) 69, 77, 145, 156
Eco24I GRGCYC 1 cut(s) 79
Eco47I GGWCC 1 cut(s) 5
EcoO109I RGGNCCY 2 cut(s) 5, 75
EcoT38I GRGCYC 1 cut(s) 79
FaiI YATR 3 cut(s) 128, 159, 171
FriOI GRGCYC 1 cut(s) 79
HaeIII GGCC 1 cut(s) 77
HinfI GANTC 1 cut(s) 38
Hpy188I TCNGA 1 cut(s) 64
Hpy188III TCNNGA 1 cut(s) 113
HpyCH4III ACNGT 1 cut(s) 87
LpnPI CCDG 5 cut(s) 21, 65, 92, 106, 118
MhlI GDGCHC 1 cut(s) 79
MluCI AATT 1 cut(s) 121
MnlI CCTC 1 cut(s) 30
Mva1269I GAATGC 1 cut(s) 108
NlaIV GGNNCC 3 cut(s) 6, 76, 77
PctI GAATGC 1 cut(s) 108
PfeI GAWTC 1 cut(s) 38
PpuMI RGGWCCY 1 cut(s) 5
Psp5II RGGWCCY 1 cut(s) 5
PspN4I GGNNCC 3 cut(s) 6, 76, 77
PspOMI GGGCCC 1 cut(s) 75
PspPI GGNCC 3 cut(s) 5, 75, 76
PspPPI RGGWCCY 1 cut(s) 5
Sau96I GGNCC 3 cut(s) 5, 75, 76
SduI GDGCHC 1 cut(s) 79
SetI ASST 3 cut(s) 71, 137, 147
SgeI CNNG 9 cut(s) 20, 64, 76, 85, 91, 105, 117, 125, 145
SinI GGWCC 1 cut(s) 5
Sse9I AATT 1 cut(s) 121
SsiI CCGC 1 cut(s) 48
TaaI ACNGT 1 cut(s) 87
TaqI TCGA 2 cut(s) 36, 149
TasI AATT 1 cut(s) 121
TfiI GAWTC 1 cut(s) 38
TspDTI ATGAA 2 cut(s) 71, 189
VpaK11BI GGWCC 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.