Prupe.1G124800_v2.0.a1

Acylpyruvase FAHD1

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Reverse (-)
9849938 .. 9850538
601 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G124800.1

Sequence Viewer

Length: 195 bp
ATGATATTTAAGCTCCCATTTCTCATCGGCCACATAAGCTCTATTATGACACTTCTTGAAGGAGATGTAATACTAACAGGCACTCCCAAAGGTGTTGGCCCAGTTAAAGTAGGTCAAAAGATAACTGCTGGCATAACGAACCTCCTGGACGTTGAATTCAATGTTGAAAAAAGGCAGAAGCAAGGAAGCTCTTGA

Protein Analysis

65

Amino Acids

6.87

Weight (kDa)

9.3

Isoelectric Point (pI)

29.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 28
AcsI RAATTY 1 cut(s) 155
AgsI TTSAA 4 cut(s) 59, 155, 160, 167
AjnI CCWGG 1 cut(s) 144
AluBI AGCT 3 cut(s) 13, 39, 189
AluI AGCT 3 cut(s) 13, 39, 189
AoxI GGCC 2 cut(s) 28, 97
ApoI RAATTY 1 cut(s) 155
AspS9I GGNCC 1 cut(s) 98
BciT130I CCWGG 1 cut(s) 146
Bme1390I CCNGG 1 cut(s) 146
BmgT120I GGNCC 1 cut(s) 98
BmrFI CCNGG 1 cut(s) 146
BmrI ACTGGG 1 cut(s) 95
BmuI ACTGGG 1 cut(s) 95
BsaXI ACNNNNNCTCC 2 cut(s) 67, 97
Bse1I ACTGG 1 cut(s) 101
BseBI CCWGG 1 cut(s) 146
BseNI ACTGG 1 cut(s) 101
BshFI GGCC 2 cut(s) 30, 99
BsnI GGCC 2 cut(s) 30, 99
BspANI GGCC 2 cut(s) 30, 99
BsrI ACTGG 1 cut(s) 101
Bst2UI CCWGG 1 cut(s) 146
BstC8I GCNNGC 1 cut(s) 130
BstMWI GCNNNNNNNGC 1 cut(s) 36
BstNI CCWGG 1 cut(s) 146
BstSCI CCNGG 1 cut(s) 144
BsuRI GGCC 2 cut(s) 30, 99
Cac8I GCNNGC 1 cut(s) 130
Cfr13I GGNCC 1 cut(s) 98
CviJI RGCY 5 cut(s) 13, 30, 39, 99, 189
CviKI_1 RGCY 5 cut(s) 13, 30, 39, 99, 189
EaeI YGGCCR 1 cut(s) 28
EcoRI GAATTC 1 cut(s) 155
EcoRII CCWGG 1 cut(s) 144
FaiI YATR 3 cut(s) 35, 47, 134
HaeIII GGCC 2 cut(s) 30, 99
Hpy188III TCNNGA 2 cut(s) 56, 192
HpyAV CCTTC 1 cut(s) 53
HpyCH4IV ACGT 1 cut(s) 150
HpyF10VI GCNNNNNNNGC 1 cut(s) 36
HpySE526I ACGT 1 cut(s) 150
LmnI GCTCC 1 cut(s) 18
LpnPI CCDG 5 cut(s) 63, 114, 114, 131, 158
MaeII ACGT 1 cut(s) 150
MluCI AATT 1 cut(s) 155
MnlI CCTC 1 cut(s) 152
MseI TTAA 2 cut(s) 9, 105
MspR9I CCNGG 1 cut(s) 146
MvaI CCWGG 1 cut(s) 146
MwoI GCNNNNNNNGC 1 cut(s) 36
PfoI TCCNGGA 1 cut(s) 144
Psp6I CCWGG 1 cut(s) 144
PspGI CCWGG 1 cut(s) 144
PspPI GGNCC 1 cut(s) 98
SaqAI TTAA 2 cut(s) 9, 105
Sau96I GGNCC 1 cut(s) 98
ScrFI CCNGG 1 cut(s) 146
SetI ASST 7 cut(s) 15, 41, 94, 115, 144, 153, 191
SgeI CNNG 6 cut(s) 68, 90, 113, 141, 157, 158
Sse9I AATT 1 cut(s) 155
StyD4I CCNGG 1 cut(s) 144
TaiI ACGT 1 cut(s) 153
TasI AATT 1 cut(s) 155
Tru1I TTAA 2 cut(s) 9, 105
Tru9I TTAA 2 cut(s) 9, 105
XapI RAATTY 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.