RLG00000033195

Acylpyruvase FAHD1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
OG0002365
Physical Location & Seq
Forward (+)
24370597 .. 24371662
1066 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000033195

Sequence Viewer

Length: 393 bp
ATGAAGGAGCCTGTGCTTTTTCTCAAACCGACGTCGTCTTACTTGAAAAACGGAGGCACCATCGAAATCCCTCACCCTCTGGAGTCGTTGGACCATGAGGTGGAGCTGACTATCATCATATCCAAGAAAGCTCGCGATGTTCCCCAGGCCAAGGCGATGGATTACGTTGGTGGTTATGCACTTGCTCTTGATATGACTGCCAGAGAGATTCAAGCTACTGCTAAGTTACTGCAGACTTGGCTCAGAGCGGTAACTCCGTCGAAGCCCTCTGAGCCTTTTCTTCAATGCAAAAGCTCTCTCAACCCTACCGCTCCTCCTTTCCTTGCTCCATCAAATCCTGCTCGGCTCTGTTGGATCTTCACTTTGGCAGGCAAGCTCACCAGCAGGCCTTGA

Protein Analysis

131

Amino Acids

14.29

Weight (kDa)

9.2

Isoelectric Point (pI)

47.85

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
FAA_hydrolase PF01557 2 - 83 3.1e-21 Fumarylacetoacetate (FAA) hydrolase C-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 35
AccB1I GGYRCC 1 cut(s) 56
AccB7I CCANNNNNTGG 1 cut(s) 100
AccBSI CCGCTC 2 cut(s) 248, 311
AccII CGCG 1 cut(s) 135
AciI CCGC 2 cut(s) 248, 309
AclWI GGATC 1 cut(s) 362
AcyI GRCGYC 1 cut(s) 32
AfiI CCNNNNNNNGG 2 cut(s) 100, 151
AgsI TTSAA 3 cut(s) 46, 212, 284
AjnI CCWGG 1 cut(s) 144
AluBI AGCT 5 cut(s) 106, 131, 215, 294, 376
AluI AGCT 5 cut(s) 106, 131, 215, 294, 376
AlwI GGATC 1 cut(s) 362
AoxI GGCC 2 cut(s) 147, 386
AspS9I GGNCC 1 cut(s) 91
AsuHPI GGTGA 2 cut(s) 65, 370
AvaII GGWCC 1 cut(s) 91
BanI GGYRCC 1 cut(s) 56
BccI CCATC 3 cut(s) 68, 151, 337
BciT130I CCWGG 1 cut(s) 146
BfmI CTRYAG 1 cut(s) 230
Bme1390I CCNGG 1 cut(s) 146
Bme18I GGWCC 1 cut(s) 91
BmgT120I GGNCC 1 cut(s) 91
BmiI GGNNCC 2 cut(s) 9, 58
BmrFI CCNGG 1 cut(s) 146
BpmI CTGGAG 1 cut(s) 101
BsaHI GRCGYC 1 cut(s) 32
BsaJI CCNNGG 2 cut(s) 144, 150
BsaXI ACNNNNNCTCC 2 cut(s) 298, 328
Bsc4I CCNNNNNNNGG 2 cut(s) 100, 151
BseBI CCWGG 1 cut(s) 146
BseDI CCNNGG 2 cut(s) 144, 150
BseLI CCNNNNNNNGG 2 cut(s) 100, 151
BseMII CTCAG 2 cut(s) 256, 261
BseRI GAGGAG 1 cut(s) 303
Bsh1236I CGCG 1 cut(s) 135
BshFI GGCC 2 cut(s) 149, 388
BshNI GGYRCC 1 cut(s) 56
BslI CCNNNNNNNGG 2 cut(s) 100, 151
BsnI GGCC 2 cut(s) 149, 388
Bsp143I GATC 1 cut(s) 354
Bsp68I TCGCGA 1 cut(s) 135
BspACI CCGC 2 cut(s) 248, 309
BspANI GGCC 2 cut(s) 149, 388
BspCNI CTCAG 2 cut(s) 255, 262
BspFNI CGCG 1 cut(s) 135
BspLI GGNNCC 2 cut(s) 9, 58
BspMAI CTGCAG 1 cut(s) 234
BspPI GGATC 1 cut(s) 362
BspT107I GGYRCC 1 cut(s) 56
BsrBI CCGCTC 2 cut(s) 248, 311
BssECI CCNNGG 2 cut(s) 144, 150
BssMI GATC 1 cut(s) 354
BssNI GRCGYC 1 cut(s) 32
BssT1I CCWWGG 1 cut(s) 150
Bst2UI CCWGG 1 cut(s) 146
BstACI GRCGYC 1 cut(s) 32
BstC8I GCNNGC 4 cut(s) 133, 370, 374, 386
BstDEI CTNAG 3 cut(s) 222, 242, 270
BstFNI CGCG 1 cut(s) 135
BstKTI GATC 1 cut(s) 357
BstMBI GATC 1 cut(s) 354
BstMWI GCNNNNNNNGC 2 cut(s) 238, 271
BstNI CCWGG 1 cut(s) 146
BstSCI CCNGG 1 cut(s) 144
BstSFI CTRYAG 1 cut(s) 230
BstUI CGCG 1 cut(s) 135
BstX2I RGATCY 1 cut(s) 354
BstXI CCANNNNNNTGG 1 cut(s) 157
BstYI RGATCY 1 cut(s) 354
BsuRI GGCC 2 cut(s) 149, 388
BtgZI GCGATG 2 cut(s) 150, 170
BtuMI TCGCGA 1 cut(s) 135
Cac8I GCNNGC 4 cut(s) 133, 370, 374, 386
Cfr13I GGNCC 1 cut(s) 91
CviAII CATG 1 cut(s) 95
DdeI CTNAG 3 cut(s) 222, 242, 270
DpnI GATC 1 cut(s) 356
DpnII GATC 1 cut(s) 354
Eco130I CCWWGG 1 cut(s) 150
Eco147I AGGCCT 1 cut(s) 388
Eco47I GGWCC 1 cut(s) 91
EcoRII CCWGG 1 cut(s) 144
EcoT14I CCWWGG 1 cut(s) 150
ErhI CCWWGG 1 cut(s) 150
FaeI CATG 1 cut(s) 98
FaiI YATR 4 cut(s) 96, 119, 177, 194
FatI CATG 1 cut(s) 94
GsuI CTGGAG 1 cut(s) 101
HaeIII GGCC 2 cut(s) 149, 388
Hin1I GRCGYC 1 cut(s) 32
Hin1II CATG 1 cut(s) 98
HinfI GANTC 2 cut(s) 83, 208
HphI GGTGA 2 cut(s) 65, 370
Hpy188I TCNGA 2 cut(s) 245, 271
Hpy188III TCNNGA 3 cut(s) 80, 134, 188
Hpy99I CGWCG 3 cut(s) 34, 37, 262
HpyCH4IV ACGT 2 cut(s) 32, 165
HpyCH4V TGCA 3 cut(s) 179, 232, 288
HpyF10VI GCNNNNNNNGC 2 cut(s) 238, 271
HpyF3I CTNAG 3 cut(s) 222, 242, 270
HpySE526I ACGT 2 cut(s) 32, 165
Hsp92I GRCGYC 1 cut(s) 32
Hsp92II CATG 1 cut(s) 98
Kzo9I GATC 1 cut(s) 354
LmnI GCTCC 4 cut(s) 7, 103, 316, 331
LpnPI CCDG 8 cut(s) 24, 65, 131, 158, 214, 351, 354, 370
MaeII ACGT 2 cut(s) 32, 165
MaeIII GTNAC 2 cut(s) 225, 250
MalI GATC 1 cut(s) 356
MbiI CCGCTC 2 cut(s) 248, 311
MboI GATC 1 cut(s) 354
MboII GAAGA 2 cut(s) 272, 349
MflI RGATCY 1 cut(s) 354
MlyI GAGTC 1 cut(s) 92
MmeI TCCRAC 2 cut(s) 69, 332
MnlI CCTC 6 cut(s) 47, 81, 87, 91, 277, 324
MspR9I CCNGG 1 cut(s) 146
MvaI CCWGG 1 cut(s) 146
MvnI CGCG 1 cut(s) 135
MwoI GCNNNNNNNGC 2 cut(s) 238, 271
NdeII GATC 1 cut(s) 354
NlaIII CATG 1 cut(s) 98
NlaIV GGNNCC 2 cut(s) 9, 58
NmeAIII GCCGAG 1 cut(s) 322
NruI TCGCGA 1 cut(s) 135
PceI AGGCCT 1 cut(s) 388
PfeI GAWTC 1 cut(s) 208
PflFI GACNNNGTC 1 cut(s) 34
PflMI CCANNNNNTGG 1 cut(s) 100
PleI GAGTC 1 cut(s) 91
PpsI GAGTC 1 cut(s) 91
Psp6I CCWGG 1 cut(s) 144
PspGI CCWGG 1 cut(s) 144
PspN4I GGNNCC 2 cut(s) 9, 58
PspPI GGNCC 1 cut(s) 91
PstI CTGCAG 1 cut(s) 234
PsuI RGATCY 1 cut(s) 354
PsyI GACNNNGTC 1 cut(s) 34
RruI TCGCGA 1 cut(s) 135
Sau3AI GATC 1 cut(s) 354
Sau96I GGNCC 1 cut(s) 91
SchI GAGTC 1 cut(s) 92
ScrFI CCNGG 1 cut(s) 146
SetI ASST 8 cut(s) 35, 102, 108, 133, 168, 217, 296, 378
SfcI CTRYAG 1 cut(s) 230
SinI GGWCC 1 cut(s) 91
SseBI AGGCCT 1 cut(s) 388
SsiI CCGC 2 cut(s) 248, 309
StuI AGGCCT 1 cut(s) 388
StyD4I CCNGG 1 cut(s) 144
StyI CCWWGG 1 cut(s) 150
TaiI ACGT 2 cut(s) 35, 168
TaqI TCGA 2 cut(s) 63, 260
TfiI GAWTC 1 cut(s) 208
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 2 cut(s) 66, 246
Tth111I GACNNNGTC 1 cut(s) 34
Van91I CCANNNNNTGG 1 cut(s) 100
VpaK11BI GGWCC 1 cut(s) 91
ZraI GACGTC 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.