Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

SuperScaffold_420

Orthogroup ID

OG0001878

Physical Location & Seq

Genomic Coordinates Reverse (-)

1888490 .. 1889606

Gene Structure 1117 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom420g01360.3

Sequence Viewer

CDS Protein Promoter (2k)

Length: 462 bp

ATGAAGTTGATATTTTTGGGTAGCTCTTTCTCAATTGTTTGGTACATACGGTGCCACAGGATTGTTCGGAGATCATATGATAAGGACCAAGATACATTTCGCCATCTTTTTCTCCTGCTCCCTTGCCTCATTTTGGCCCTGGTTATAAATGAGAAATTCACTTTTAAAGAGGTGCTGTGGACGTTTTCCATATATTTGGAAGCAGTTGCCATACTTCCTCAGCTGGTGCTGTTGCAAAGGACAAGAAATATTGACAACTTAACAGGACAATATGTTTTCCTCCTTGGCGCTTATCGAGCATTATACATATTGAACTGGATTTACCGCTACTTTACTGAGGAACACTATGTCCACTGGATAACTTGGATCGCAGGGATTATCCAGACTTTGCTCTATGCTGATTTCTTCTACTATTACTTCCAGAGCTGGAAGAACAATGTAAAGCTCGAGCTACCAGCTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko05110 map05110

Pfam Domains

Protein Families

ER_lumen_recept

Protein Analysis

154

Amino Acids

18.61

Weight (kDa)

9.06

Isoelectric Point (pI)

44.88

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001878)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G25040
fragaria_vesca	FvH4_2g18780 FvH4_4g16540 FvH4_7g33860
malus_domestica	MD04G1009900.v1.1 MD05G1173800.v1.1 MD07G1307200.v1.1 MD10G1161700.v1.1
prunus_persica	Prupe.1G009000_v2.0.a1 Prupe.1G009000_v2.0.a1 Prupe.2G324900_v2.0.a1 Prupe.2G324900_v2.0.a1 Prupe.8G201200_v2.0.a1 Prupe.8G201200_v2.0.a1
pyrus_communis	pycom04g00790 pycom05g16050 pycom07g28010 pycom10g13970 pycom420g01360
rosa_chinensis	RchiOBHm_Chr1g0383971 RchiOBHm_Chr4g0415041 RchiOBHm_Chr6g0284521
rosa_laevigata	RLG00000012741 RLG00000026082
rosa_multiflora	Rmu_co8317209.1_g000001 Rmu_sc0003611.1_g000016 Rmu_sc0005139.1_g000023 Rmu_sc0005257.1_g000002 Rmu_sc0008157.1_g000010
rosa_roxburghii	Rroxscaffold_4G00277090 Rroxscaffold_5G00358830 Rroxscaffold_7G00184640
rosa_rugosa	Rorug01G0443900 Rorug03G0185300 Rorug04G0132100 Rorug06G0164000
rosa_samantha	Rh1BG427200 Rh1DG460000 Rh4CG202300 Rh5BG021800 Rh6BG244900 Rh6CG279100 Rh6CG458100
rosa_wichuraiana	Rw1G040290 Rw4G016270 Rw6G023790

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	146
AccB1I	GGYRCC	1 cut(s)	51
AciI	CCGC	1 cut(s)	325
AclWI	GGATC	1 cut(s)	374
AcsI	RAATTY	1 cut(s)	155
AfaI	GTAC	1 cut(s)	44
AfiI	CCNNNNNNNGG	1 cut(s)	133
AgsI	TTSAA	1 cut(s)	313
AjnI	CCWGG	1 cut(s)	138
AjuI	GAANNNNNNNTTGG	2 cut(s)	81, 113
AloI	GAACNNNNNNTCC	2 cut(s)	333, 365
AluBI	AGCT	6 cut(s)	24, 223, 426, 445, 451, 458
AluI	AGCT	6 cut(s)	24, 223, 426, 445, 451, 458
AlwI	GGATC	1 cut(s)	374
Ama87I	CYCGRG	1 cut(s)	446
AoxI	GGCC	1 cut(s)	135
ApoI	RAATTY	1 cut(s)	155
AspLEI	GCGC	1 cut(s)	290
AspS9I	GGNCC	2 cut(s)	85, 136
AvaI	CYCGRG	1 cut(s)	446
AvaII	GGWCC	1 cut(s)	85
BanI	GGYRCC	1 cut(s)	51
BbvCI	CCTCAGC	1 cut(s)	219
BccI	CCATC	1 cut(s)	111
BciT130I	CCWGG	1 cut(s)	140
BfoI	RGCGCY	1 cut(s)	291
Bme1390I	CCNGG	1 cut(s)	140
Bme18I	GGWCC	1 cut(s)	85
BmeT110I	CYCGRG	1 cut(s)	446
BmgT120I	GGNCC	2 cut(s)	85, 136
BmiI	GGNNCC	1 cut(s)	53
BmrFI	CCNGG	1 cut(s)	140
Bpu10I	CCTNAGC	1 cut(s)	219
BsaJI	CCNNGG	2 cut(s)	138, 283
Bsc4I	CCNNNNNNNGG	1 cut(s)	133
Bse1I	ACTGG	2 cut(s)	320, 359
BseBI	CCWGG	1 cut(s)	140
BseDI	CCNNGG	2 cut(s)	138, 283
BseLI	CCNNNNNNNGG	1 cut(s)	133
BseMII	CTCAG	2 cut(s)	233, 327
BseNI	ACTGG	2 cut(s)	320, 359
BshFI	GGCC	1 cut(s)	137
BshNI	GGYRCC	1 cut(s)	51
BsiHKCI	CYCGRG	1 cut(s)	446
BslI	CCNNNNNNNGG	1 cut(s)	133
BsnI	GGCC	1 cut(s)	137
BsoBI	CYCGRG	1 cut(s)	446
Bsp143I	GATC	2 cut(s)	71, 366
BspACI	CCGC	1 cut(s)	325
BspANI	GGCC	1 cut(s)	137
BspCNI	CTCAG	2 cut(s)	232, 328
BspLI	GGNNCC	1 cut(s)	53
BspPI	GGATC	1 cut(s)	374
BspT107I	GGYRCC	1 cut(s)	51
BsrI	ACTGG	2 cut(s)	320, 359
BssECI	CCNNGG	2 cut(s)	138, 283
BssMI	GATC	2 cut(s)	71, 366
BssT1I	CCWWGG	1 cut(s)	283
Bst2UI	CCWGG	1 cut(s)	140
Bst4CI	ACNGT	1 cut(s)	51
BstDEI	CTNAG	2 cut(s)	219, 336
BstH2I	RGCGCY	1 cut(s)	291
BstHHI	GCGC	1 cut(s)	290
BstKTI	GATC	2 cut(s)	74, 369
BstMBI	GATC	2 cut(s)	71, 366
BstMWI	GCNNNNNNNGC	1 cut(s)	296
BstNI	CCWGG	1 cut(s)	140
BstSCI	CCNGG	1 cut(s)	138
BstXI	CCANNNNNNTGG	1 cut(s)	196
BsuRI	GGCC	1 cut(s)	137
BtsIMutI	CAGTG	1 cut(s)	352
CfoI	GCGC	1 cut(s)	290
Cfr13I	GGNCC	2 cut(s)	85, 136
Csp6I	GTAC	1 cut(s)	43
CviJI	RGCY	7 cut(s)	24, 137, 223, 426, 445, 451, 458
CviKI_1	RGCY	7 cut(s)	24, 137, 223, 426, 445, 451, 458
CviQI	GTAC	1 cut(s)	43
DdeI	CTNAG	2 cut(s)	219, 336
DpnI	GATC	2 cut(s)	73, 368
DpnII	GATC	2 cut(s)	71, 366
DraI	TTTAAA	1 cut(s)	166
Eco130I	CCWWGG	1 cut(s)	283
Eco47I	GGWCC	1 cut(s)	85
Eco88I	CYCGRG	1 cut(s)	446
EcoRII	CCWGG	1 cut(s)	138
EcoT14I	CCWWGG	1 cut(s)	283
ErhI	CCWWGG	1 cut(s)	283
FauNDI	CATATG	1 cut(s)	76
GlaI	GCGC	1 cut(s)	289
HaeII	RGCGCY	1 cut(s)	291
HaeIII	GGCC	1 cut(s)	137
HhaI	GCGC	1 cut(s)	290
Hin6I	GCGC	1 cut(s)	288
HinP1I	GCGC	1 cut(s)	288
Hpy166II	GTNNAC	2 cut(s)	180, 352
Hpy188I	TCNGA	1 cut(s)	69
Hpy188III	TCNNGA	2 cut(s)	382, 421
Hpy8I	GTNNAC	2 cut(s)	180, 352
HpyCH4III	ACNGT	1 cut(s)	51
HpyCH4IV	ACGT	1 cut(s)	182
HpyCH4V	TGCA	1 cut(s)	235
HpyF10VI	GCNNNNNNNGC	1 cut(s)	296
HpyF3I	CTNAG	2 cut(s)	219, 336
HpySE526I	ACGT	1 cut(s)	182
HspAI	GCGC	1 cut(s)	288
Kzo9I	GATC	2 cut(s)	71, 366
LmnI	GCTCC	1 cut(s)	123
MaeII	ACGT	1 cut(s)	182
MalI	GATC	2 cut(s)	73, 368
MboI	GATC	2 cut(s)	71, 366
MboII	GAAGA	2 cut(s)	397, 442
MfeI	CAATTG	1 cut(s)	33
MluCI	AATT	2 cut(s)	33, 155
MnlI	CCTC	5 cut(s)	137, 163, 228, 290, 331
MseI	TTAA	2 cut(s)	165, 260
MspA1I	CMGCKG	1 cut(s)	223
MspR9I	CCNGG	1 cut(s)	140
MunI	CAATTG	1 cut(s)	33
MvaI	CCWGG	1 cut(s)	140
MwoI	GCNNNNNNNGC	1 cut(s)	296
NdeI	CATATG	1 cut(s)	76
NdeII	GATC	2 cut(s)	71, 366
NlaIV	GGNNCC	1 cut(s)	53
PaeR7I	CTCGAG	1 cut(s)	446
PsiI	TTATAA	1 cut(s)	146
Psp6I	CCWGG	1 cut(s)	138
PspGI	CCWGG	1 cut(s)	138
PspN4I	GGNNCC	1 cut(s)	53
PspPI	GGNCC	2 cut(s)	85, 136
PspXI	VCTCGAGB	1 cut(s)	446
PsrI	GAACNNNNNNTAC	2 cut(s)	305, 337
PvuII	CAGCTG	1 cut(s)	223
RsaI	GTAC	1 cut(s)	44
RsaNI	GTAC	1 cut(s)	43
SaqAI	TTAA	2 cut(s)	165, 260
Sau3AI	GATC	2 cut(s)	71, 366
Sau96I	GGNCC	2 cut(s)	85, 136
ScrFI	CCNGG	1 cut(s)	140
SetI	ASST	8 cut(s)	26, 174, 185, 225, 428, 447, 453, 460
Sfr274I	CTCGAG	1 cut(s)	446
SinI	GGWCC	1 cut(s)	85
SlaI	CTCGAG	1 cut(s)	446
SmlI	CTYRAG	1 cut(s)	446
SmoI	CTYRAG	1 cut(s)	446
Sse9I	AATT	2 cut(s)	33, 155
SsiI	CCGC	1 cut(s)	325
SspI	AATATT	1 cut(s)	250
StyD4I	CCNGG	1 cut(s)	138
StyI	CCWWGG	1 cut(s)	283
TaaI	ACNGT	1 cut(s)	51
TaiI	ACGT	1 cut(s)	185
TaqI	TCGA	2 cut(s)	295, 447
TasI	AATT	2 cut(s)	33, 155
Tru1I	TTAA	2 cut(s)	165, 260
Tru9I	TTAA	2 cut(s)	165, 260
TscAI	CASTG	1 cut(s)	359
TspDTI	ATGAA	1 cut(s)	17
TspRI	CASTG	1 cut(s)	359
VpaK11BI	GGWCC	1 cut(s)	85
XapI	RAATTY	1 cut(s)	155
XhoI	CTCGAG	1 cut(s)	446

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.