Rmu_co8317209.1_g000001

ER lumen

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8317209.1
Physical Location & Seq
Reverse (-)
1 .. 782
782 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8317209.1_g000001.1.cds

Sequence Viewer

Length: 287 bp
atgaagttgatattcttgggtagctctttctcaattgtttggtatatacggcaccacaggattgttcgtagatcatatgataaagaccaagacacatttcgccatctttttctgttactcccatgcctacttttggccctggtcatcaatgagaaattcacttttagagaggtgatgtgggctttttccatatatttggaagcagtcgccatacttcctcagctggtgctgttgcaaaggacaagaaatattgacaacctaacagggcaatatgtagtcctcctcgg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

96

Amino Acids

11.41

Weight (kDa)

9.65

Isoelectric Point (pI)

43.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 51
AcsI RAATTY 1 cut(s) 155
AfiI CCNNNNNNNGG 1 cut(s) 133
AjnI CCWGG 1 cut(s) 138
AjuI GAANNNNNNNTTGG 2 cut(s) 81, 113
AluBI AGCT 2 cut(s) 24, 223
AluI AGCT 2 cut(s) 24, 223
AoxI GGCC 1 cut(s) 135
ApoI RAATTY 1 cut(s) 155
AspS9I GGNCC 1 cut(s) 136
AsuHPI GGTGA 1 cut(s) 184
BanI GGYRCC 1 cut(s) 51
BbvCI CCTCAGC 1 cut(s) 219
BccI CCATC 1 cut(s) 111
BceAI ACGGC 1 cut(s) 65
BciT130I CCWGG 1 cut(s) 140
Bme1390I CCNGG 1 cut(s) 140
BmgT120I GGNCC 1 cut(s) 136
BmiI GGNNCC 1 cut(s) 53
BmrFI CCNGG 1 cut(s) 140
Bpu10I CCTNAGC 1 cut(s) 219
BsaJI CCNNGG 2 cut(s) 138, 283
Bsc4I CCNNNNNNNGG 1 cut(s) 133
BseBI CCWGG 1 cut(s) 140
BseDI CCNNGG 2 cut(s) 138, 283
BseLI CCNNNNNNNGG 1 cut(s) 133
BseMII CTCAG 1 cut(s) 233
BseRI GAGGAG 1 cut(s) 272
BshFI GGCC 1 cut(s) 137
BshNI GGYRCC 1 cut(s) 51
BslI CCNNNNNNNGG 1 cut(s) 133
BsnI GGCC 1 cut(s) 137
Bsp143I GATC 1 cut(s) 71
BspANI GGCC 1 cut(s) 137
BspCNI CTCAG 1 cut(s) 232
BspLI GGNNCC 1 cut(s) 53
BspT107I GGYRCC 1 cut(s) 51
BssECI CCNNGG 2 cut(s) 138, 283
BssMI GATC 1 cut(s) 71
Bst2UI CCWGG 1 cut(s) 140
BstDEI CTNAG 1 cut(s) 219
BstKTI GATC 1 cut(s) 74
BstMBI GATC 1 cut(s) 71
BstNI CCWGG 1 cut(s) 140
BstSCI CCNGG 1 cut(s) 138
BstXI CCANNNNNNTGG 1 cut(s) 196
BsuRI GGCC 1 cut(s) 137
Cfr13I GGNCC 1 cut(s) 136
CviAII CATG 1 cut(s) 123
CviJI RGCY 4 cut(s) 24, 137, 182, 223
CviKI_1 RGCY 4 cut(s) 24, 137, 182, 223
DdeI CTNAG 1 cut(s) 219
DpnI GATC 1 cut(s) 73
DpnII GATC 1 cut(s) 71
EcoRII CCWGG 1 cut(s) 138
FaeI CATG 1 cut(s) 126
FaiI YATR 9 cut(s) 45, 47, 76, 78, 124, 191, 193, 212, 273
FatI CATG 1 cut(s) 122
FauNDI CATATG 1 cut(s) 76
HaeIII GGCC 1 cut(s) 137
Hin1II CATG 1 cut(s) 126
HphI GGTGA 1 cut(s) 184
HpyCH4V TGCA 1 cut(s) 235
HpyF3I CTNAG 1 cut(s) 219
Hsp92II CATG 1 cut(s) 126
Kzo9I GATC 1 cut(s) 71
LpnPI CCDG 5 cut(s) 43, 125, 152, 209, 249
MaeIII GTNAC 1 cut(s) 114
MalI GATC 1 cut(s) 73
MboI GATC 1 cut(s) 71
MfeI CAATTG 1 cut(s) 33
MluCI AATT 2 cut(s) 33, 155
MnlI CCTC 2 cut(s) 163, 228
MspA1I CMGCKG 1 cut(s) 223
MspR9I CCNGG 1 cut(s) 140
MunI CAATTG 1 cut(s) 33
MvaI CCWGG 1 cut(s) 140
NdeI CATATG 1 cut(s) 76
NdeII GATC 1 cut(s) 71
NlaIII CATG 1 cut(s) 126
NlaIV GGNNCC 1 cut(s) 53
Psp6I CCWGG 1 cut(s) 138
PspGI CCWGG 1 cut(s) 138
PspN4I GGNNCC 1 cut(s) 53
PspPI GGNCC 1 cut(s) 136
PvuII CAGCTG 1 cut(s) 223
Sau3AI GATC 1 cut(s) 71
Sau96I GGNCC 1 cut(s) 136
ScrFI CCNGG 1 cut(s) 140
SetI ASST 4 cut(s) 26, 174, 225, 261
SgeI CNNG 9 cut(s) 28, 70, 101, 135, 151, 152, 236, 255, 276
Sse9I AATT 2 cut(s) 33, 155
SspI AATATT 1 cut(s) 250
StyD4I CCNGG 1 cut(s) 138
TasI AATT 2 cut(s) 33, 155
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.