Rh5BG021800

ER lumen

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
1595069 .. 1597610
2542 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG021800.1

Sequence Viewer

Length: 204 bp
ATGAACCAGGTCATGCGGTCATTTTCATTATTTTTAGAAGCTGTTGCTATCCTTCCTCAGCTTGTGCTGTTACAGAGAACGAGAAATATTGACAACTTGACAGGGCAATACGTCTTCCTCCTTGGGTATTCCAAACACCCTGATATTTTCTTTACAAATACAATTCTATATCATATTTTTGGTTCCTTCATTAGACCTATATAA

Protein Analysis

67

Amino Acids

7.83

Weight (kDa)

9.52

Isoelectric Point (pI)

40.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ER_lumen_recept PF00810 2 - 49 1.2e-14 ER lumen protein retaining receptor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 16
AjnI CCWGG 1 cut(s) 6
AluBI AGCT 2 cut(s) 41, 61
AluI AGCT 2 cut(s) 41, 61
BbsI GAAGAC 1 cut(s) 106
BbvCI CCTCAGC 1 cut(s) 57
BciT130I CCWGG 1 cut(s) 8
Bme1390I CCNGG 1 cut(s) 8
BmiI GGNNCC 1 cut(s) 184
BmrFI CCNGG 1 cut(s) 8
BpiI GAAGAC 1 cut(s) 106
Bpu10I CCTNAGC 1 cut(s) 57
BsaJI CCNNGG 1 cut(s) 121
BseBI CCWGG 1 cut(s) 8
BseDI CCNNGG 1 cut(s) 121
BseMII CTCAG 1 cut(s) 71
BspACI CCGC 1 cut(s) 16
BspCNI CTCAG 1 cut(s) 70
BspLI GGNNCC 1 cut(s) 184
BssECI CCNNGG 1 cut(s) 121
BssT1I CCWWGG 1 cut(s) 121
Bst2UI CCWGG 1 cut(s) 8
BstDEI CTNAG 1 cut(s) 57
BstNI CCWGG 1 cut(s) 8
BstSCI CCNGG 1 cut(s) 6
BstV2I GAAGAC 1 cut(s) 106
CsiI ACCWGGT 1 cut(s) 6
CviAII CATG 1 cut(s) 13
CviJI RGCY 2 cut(s) 41, 61
CviKI_1 RGCY 2 cut(s) 41, 61
DdeI CTNAG 1 cut(s) 57
Eco130I CCWWGG 1 cut(s) 121
EcoRII CCWGG 1 cut(s) 6
EcoT14I CCWWGG 1 cut(s) 121
ErhI CCWWGG 1 cut(s) 121
FaeI CATG 1 cut(s) 16
FaiI YATR 5 cut(s) 14, 169, 174, 200, 202
FatI CATG 1 cut(s) 12
Hin1II CATG 1 cut(s) 16
HpyAV CCTTC 2 cut(s) 62, 196
HpyCH4IV ACGT 1 cut(s) 111
HpyF3I CTNAG 1 cut(s) 57
HpySE526I ACGT 1 cut(s) 111
Hsp92II CATG 1 cut(s) 16
LpnPI CCDG 3 cut(s) 20, 87, 153
MabI ACCWGGT 1 cut(s) 6
MaeII ACGT 1 cut(s) 111
MaeIII GTNAC 1 cut(s) 69
MboII GAAGA 1 cut(s) 106
MluCI AATT 1 cut(s) 162
MnlI CCTC 2 cut(s) 66, 128
MspR9I CCNGG 1 cut(s) 8
MvaI CCWGG 1 cut(s) 8
NlaIII CATG 1 cut(s) 16
NlaIV GGNNCC 1 cut(s) 184
Psp6I CCWGG 1 cut(s) 6
PspGI CCWGG 1 cut(s) 6
PspN4I GGNNCC 1 cut(s) 184
ScrFI CCNGG 1 cut(s) 8
SetI ASST 5 cut(s) 12, 43, 63, 114, 199
SexAI ACCWGGT 1 cut(s) 6
SgeI CNNG 9 cut(s) 19, 20, 25, 74, 93, 109, 114, 134, 152
Sse9I AATT 1 cut(s) 162
SsiI CCGC 1 cut(s) 16
SspI AATATT 1 cut(s) 88
StyD4I CCNGG 1 cut(s) 6
StyI CCWWGG 1 cut(s) 121
TaiI ACGT 1 cut(s) 114
TasI AATT 1 cut(s) 162
TspDTI ATGAA 3 cut(s) 15, 17, 178
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.