pycom420g01360

ER lumen

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_420
Physical Location & Seq
Reverse (-)
1888490 .. 1889606
1117 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 462 bp
ATGAAGTTGATATTTTTGGGTAGCTCTTTCTCAATTGTTTGGTACATACGGTGCCACAGGATTGTTCGGAGATCATATGATAAGGACCAAGATACATTTCGCCATCTTTTTCTCCTGCTCCCTTGCCTCATTTTGGCCCTGGTTATAAATGAGAAATTCACTTTTAAAGAGGTGCTGTGGACGTTTTCCATATATTTGGAAGCAGTTGCCATACTTCCTCAGCTGGTGCTGTTGCAAAGGACAAGAAATATTGACAACTTAACAGGACAATATGTTTTCCTCCTTGGCGCTTATCGAGCATTATACATATTGAACTGGATTTACCGCTACTTTACTGAGGAACACTATGTCCACTGGATAACTTGGATCGCAGGGATTATCCAGACTTTGCTCTATGCTGATTTCTTCTACTATTACTTCCAGAGCTGGAAGAACAATGTAAAGCTCGAGCTACCAGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

154

Amino Acids

18.61

Weight (kDa)

9.06

Isoelectric Point (pI)

44.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ER_lumen_recept PF00810 1 - 109 1e-41 ER lumen protein retaining receptor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 146
AccB1I GGYRCC 1 cut(s) 51
AciI CCGC 1 cut(s) 325
AclWI GGATC 1 cut(s) 374
AcsI RAATTY 1 cut(s) 155
AfaI GTAC 1 cut(s) 44
AfiI CCNNNNNNNGG 1 cut(s) 133
AgsI TTSAA 1 cut(s) 313
AjnI CCWGG 1 cut(s) 138
AjuI GAANNNNNNNTTGG 2 cut(s) 81, 113
AloI GAACNNNNNNTCC 2 cut(s) 333, 365
AluBI AGCT 6 cut(s) 24, 223, 426, 445, 451, 458
AluI AGCT 6 cut(s) 24, 223, 426, 445, 451, 458
AlwI GGATC 1 cut(s) 374
Ama87I CYCGRG 1 cut(s) 446
AoxI GGCC 1 cut(s) 135
ApoI RAATTY 1 cut(s) 155
AspLEI GCGC 1 cut(s) 290
AspS9I GGNCC 2 cut(s) 85, 136
AvaI CYCGRG 1 cut(s) 446
AvaII GGWCC 1 cut(s) 85
BanI GGYRCC 1 cut(s) 51
BbvCI CCTCAGC 1 cut(s) 219
BccI CCATC 1 cut(s) 111
BciT130I CCWGG 1 cut(s) 140
BfoI RGCGCY 1 cut(s) 291
Bme1390I CCNGG 1 cut(s) 140
Bme18I GGWCC 1 cut(s) 85
BmeT110I CYCGRG 1 cut(s) 446
BmgT120I GGNCC 2 cut(s) 85, 136
BmiI GGNNCC 1 cut(s) 53
BmrFI CCNGG 1 cut(s) 140
Bpu10I CCTNAGC 1 cut(s) 219
BsaJI CCNNGG 2 cut(s) 138, 283
Bsc4I CCNNNNNNNGG 1 cut(s) 133
Bse1I ACTGG 2 cut(s) 320, 359
BseBI CCWGG 1 cut(s) 140
BseDI CCNNGG 2 cut(s) 138, 283
BseLI CCNNNNNNNGG 1 cut(s) 133
BseMII CTCAG 2 cut(s) 233, 327
BseNI ACTGG 2 cut(s) 320, 359
BshFI GGCC 1 cut(s) 137
BshNI GGYRCC 1 cut(s) 51
BsiHKCI CYCGRG 1 cut(s) 446
BslI CCNNNNNNNGG 1 cut(s) 133
BsnI GGCC 1 cut(s) 137
BsoBI CYCGRG 1 cut(s) 446
Bsp143I GATC 2 cut(s) 71, 366
BspACI CCGC 1 cut(s) 325
BspANI GGCC 1 cut(s) 137
BspCNI CTCAG 2 cut(s) 232, 328
BspLI GGNNCC 1 cut(s) 53
BspPI GGATC 1 cut(s) 374
BspT107I GGYRCC 1 cut(s) 51
BsrI ACTGG 2 cut(s) 320, 359
BssECI CCNNGG 2 cut(s) 138, 283
BssMI GATC 2 cut(s) 71, 366
BssT1I CCWWGG 1 cut(s) 283
Bst2UI CCWGG 1 cut(s) 140
Bst4CI ACNGT 1 cut(s) 51
BstDEI CTNAG 2 cut(s) 219, 336
BstH2I RGCGCY 1 cut(s) 291
BstHHI GCGC 1 cut(s) 290
BstKTI GATC 2 cut(s) 74, 369
BstMBI GATC 2 cut(s) 71, 366
BstMWI GCNNNNNNNGC 1 cut(s) 296
BstNI CCWGG 1 cut(s) 140
BstSCI CCNGG 1 cut(s) 138
BstXI CCANNNNNNTGG 1 cut(s) 196
BsuRI GGCC 1 cut(s) 137
BtsIMutI CAGTG 1 cut(s) 352
CfoI GCGC 1 cut(s) 290
Cfr13I GGNCC 2 cut(s) 85, 136
Csp6I GTAC 1 cut(s) 43
CviJI RGCY 7 cut(s) 24, 137, 223, 426, 445, 451, 458
CviKI_1 RGCY 7 cut(s) 24, 137, 223, 426, 445, 451, 458
CviQI GTAC 1 cut(s) 43
DdeI CTNAG 2 cut(s) 219, 336
DpnI GATC 2 cut(s) 73, 368
DpnII GATC 2 cut(s) 71, 366
DraI TTTAAA 1 cut(s) 166
Eco130I CCWWGG 1 cut(s) 283
Eco47I GGWCC 1 cut(s) 85
Eco88I CYCGRG 1 cut(s) 446
EcoRII CCWGG 1 cut(s) 138
EcoT14I CCWWGG 1 cut(s) 283
ErhI CCWWGG 1 cut(s) 283
FauNDI CATATG 1 cut(s) 76
GlaI GCGC 1 cut(s) 289
HaeII RGCGCY 1 cut(s) 291
HaeIII GGCC 1 cut(s) 137
HhaI GCGC 1 cut(s) 290
Hin6I GCGC 1 cut(s) 288
HinP1I GCGC 1 cut(s) 288
Hpy166II GTNNAC 2 cut(s) 180, 352
Hpy188I TCNGA 1 cut(s) 69
Hpy188III TCNNGA 2 cut(s) 382, 421
Hpy8I GTNNAC 2 cut(s) 180, 352
HpyCH4III ACNGT 1 cut(s) 51
HpyCH4IV ACGT 1 cut(s) 182
HpyCH4V TGCA 1 cut(s) 235
HpyF10VI GCNNNNNNNGC 1 cut(s) 296
HpyF3I CTNAG 2 cut(s) 219, 336
HpySE526I ACGT 1 cut(s) 182
HspAI GCGC 1 cut(s) 288
Kzo9I GATC 2 cut(s) 71, 366
LmnI GCTCC 1 cut(s) 123
MaeII ACGT 1 cut(s) 182
MalI GATC 2 cut(s) 73, 368
MboI GATC 2 cut(s) 71, 366
MboII GAAGA 2 cut(s) 397, 442
MfeI CAATTG 1 cut(s) 33
MluCI AATT 2 cut(s) 33, 155
MnlI CCTC 5 cut(s) 137, 163, 228, 290, 331
MseI TTAA 2 cut(s) 165, 260
MspA1I CMGCKG 1 cut(s) 223
MspR9I CCNGG 1 cut(s) 140
MunI CAATTG 1 cut(s) 33
MvaI CCWGG 1 cut(s) 140
MwoI GCNNNNNNNGC 1 cut(s) 296
NdeI CATATG 1 cut(s) 76
NdeII GATC 2 cut(s) 71, 366
NlaIV GGNNCC 1 cut(s) 53
PaeR7I CTCGAG 1 cut(s) 446
PsiI TTATAA 1 cut(s) 146
Psp6I CCWGG 1 cut(s) 138
PspGI CCWGG 1 cut(s) 138
PspN4I GGNNCC 1 cut(s) 53
PspPI GGNCC 2 cut(s) 85, 136
PspXI VCTCGAGB 1 cut(s) 446
PsrI GAACNNNNNNTAC 2 cut(s) 305, 337
PvuII CAGCTG 1 cut(s) 223
RsaI GTAC 1 cut(s) 44
RsaNI GTAC 1 cut(s) 43
SaqAI TTAA 2 cut(s) 165, 260
Sau3AI GATC 2 cut(s) 71, 366
Sau96I GGNCC 2 cut(s) 85, 136
ScrFI CCNGG 1 cut(s) 140
SetI ASST 8 cut(s) 26, 174, 185, 225, 428, 447, 453, 460
Sfr274I CTCGAG 1 cut(s) 446
SinI GGWCC 1 cut(s) 85
SlaI CTCGAG 1 cut(s) 446
SmlI CTYRAG 1 cut(s) 446
SmoI CTYRAG 1 cut(s) 446
Sse9I AATT 2 cut(s) 33, 155
SsiI CCGC 1 cut(s) 325
SspI AATATT 1 cut(s) 250
StyD4I CCNGG 1 cut(s) 138
StyI CCWWGG 1 cut(s) 283
TaaI ACNGT 1 cut(s) 51
TaiI ACGT 1 cut(s) 185
TaqI TCGA 2 cut(s) 295, 447
TasI AATT 2 cut(s) 33, 155
Tru1I TTAA 2 cut(s) 165, 260
Tru9I TTAA 2 cut(s) 165, 260
TscAI CASTG 1 cut(s) 359
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 359
VpaK11BI GGWCC 1 cut(s) 85
XapI RAATTY 1 cut(s) 155
XhoI CTCGAG 1 cut(s) 446
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.