RchiOBHm_Chr5g0021091

UDP-glucose flavonoid 3-O-glucosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
15353360 .. 15354031
672 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 237 bp
ATGAGCAAATCGGAGGTGGTGTTCATCTCAACCCCCGCAATCGGAAACCTAGTCCCACTCGTCGAGTTCGCTCAGCTCCTAGTCAACCATGACCCTCGATTCCACGCCACCATCCTCATCATCACCATGCCCCAAAGACCCACCGTCAACACTTACATCCAATCCCACGCCTCCGCGTCAGCCACCAGCATCAACTTCCTCCACCTTGTAATATCAGCAATAACATATGTGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.56

Weight (kDa)

6.9

Isoelectric Point (pI)

36.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 176
AciI CCGC 2 cut(s) 36, 174
AfiI CCNNNNNNNGG 1 cut(s) 41
AhdI GACNNNNNGTC 1 cut(s) 143
AloI GAACNNNNNNTCC 1 cut(s) 37
AluBI AGCT 1 cut(s) 76
AluI AGCT 1 cut(s) 76
AsuHPI GGTGA 1 cut(s) 115
BccI CCATC 1 cut(s) 119
BfaI CTAG 3 cut(s) 50, 80, 235
BlpI GCTNAGC 1 cut(s) 72
BmeRI GACNNNNNGTC 1 cut(s) 143
BmsI GCATC 1 cut(s) 198
Bpu1102I GCTNAGC 1 cut(s) 72
BsaXI ACNNNNNCTCC 2 cut(s) 5, 35
Bsc4I CCNNNNNNNGG 1 cut(s) 41
BseGI GGATG 2 cut(s) 111, 156
BseLI CCNNNNNNNGG 1 cut(s) 41
BseMII CTCAG 1 cut(s) 86
Bsh1236I CGCG 1 cut(s) 176
BslFI GGGAC 1 cut(s) 38
BslI CCNNNNNNNGG 1 cut(s) 41
BsmFI GGGAC 1 cut(s) 38
Bsp1720I GCTNAGC 1 cut(s) 72
BspACI CCGC 2 cut(s) 36, 174
BspCNI CTCAG 1 cut(s) 85
BspFNI CGCG 1 cut(s) 176
Bst4CI ACNGT 1 cut(s) 145
BstDEI CTNAG 1 cut(s) 72
BstF5I GGATG 2 cut(s) 111, 156
BstFNI CGCG 1 cut(s) 176
BstUI CGCG 1 cut(s) 176
BtsCI GGATG 2 cut(s) 111, 156
CseI GACGC 1 cut(s) 165
CviAII CATG 2 cut(s) 89, 127
CviJI RGCY 2 cut(s) 76, 182
CviKI_1 RGCY 2 cut(s) 76, 182
DdeI CTNAG 1 cut(s) 72
DriI GACNNNNNGTC 1 cut(s) 143
Eam1105I GACNNNNNGTC 1 cut(s) 143
FaeI CATG 2 cut(s) 92, 130
FaiI YATR 4 cut(s) 90, 128, 226, 228
FaqI GGGAC 1 cut(s) 38
FatI CATG 2 cut(s) 88, 126
FauI CCCGC 1 cut(s) 43
FauNDI CATATG 1 cut(s) 226
FokI GGATG 2 cut(s) 98, 143
FspBI CTAG 3 cut(s) 50, 80, 235
HgaI GACGC 1 cut(s) 165
Hin1II CATG 2 cut(s) 92, 130
HincII GTYRAC 2 cut(s) 85, 148
HindII GTYRAC 2 cut(s) 85, 148
HinfI GANTC 1 cut(s) 99
HphI GGTGA 1 cut(s) 115
Hpy166II GTNNAC 3 cut(s) 85, 148, 232
Hpy188I TCNGA 2 cut(s) 13, 44
Hpy8I GTNNAC 3 cut(s) 85, 148, 232
Hpy99I CGWCG 1 cut(s) 65
HpyCH4III ACNGT 1 cut(s) 145
HpyF3I CTNAG 1 cut(s) 72
Hsp92II CATG 2 cut(s) 92, 130
LmnI GCTCC 1 cut(s) 81
LpnPI CCDG 1 cut(s) 199
LweI GCATC 1 cut(s) 198
MaeI CTAG 3 cut(s) 50, 80, 235
MnlI CCTC 5 cut(s) 7, 105, 125, 181, 209
MslI CAYNNNNRTG 1 cut(s) 125
MvnI CGCG 1 cut(s) 176
NdeI CATATG 1 cut(s) 226
NlaIII CATG 2 cut(s) 92, 130
PfeI GAWTC 1 cut(s) 99
RseI CAYNNNNRTG 1 cut(s) 125
SetI ASST 4 cut(s) 18, 51, 78, 207
SfaNI GCATC 1 cut(s) 198
SmiMI CAYNNNNRTG 1 cut(s) 125
SsiI CCGC 2 cut(s) 36, 174
SspMI CTAG 3 cut(s) 50, 80, 235
TaaI ACNGT 1 cut(s) 145
TaqI TCGA 2 cut(s) 63, 97
TfiI GAWTC 1 cut(s) 99
TspDTI ATGAA 1 cut(s) 13
XspI CTAG 3 cut(s) 50, 80, 235
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.